Basic Information

Symbol
MKNK2
RNA class
mRNA
Alias
MAPK Interacting Serine/Threonine Kinase 2 MNK2 GPRK7 MAP Kinase-Interacting Serine/Threonine-Protein Kinase 2 MAP Kinase Interacting Serine/Threonine Kinase 2 MAP Kinase Signal-Integrating Kinase 2 G Protein-Coupled Receptor Kinase 7 MAPK Signal-Integrating Kinase 2 EC 2.7.11.1 Putative Map Kinase Interacting Kinase EC 2.7.11 Mnk2
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Wound age identification

MANE select

Transcript ID
NM_199054.3
Sequence length
3785.0 nt
GC content
0.6188

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1622.10 kcal/mol
Thermodynamic ensemble
Free energy: -1685.04 kcal/mol
Frequency: 0.0000
Diversity: 1228.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((......(((.((((((((.(((((..((((((.((((((.((.(((((((....))))))).)).)))))).))(((((((((((((.(((((........((((.(((.(((.((...)).)))))).)))))))))))))))......(((((.((((((((..(((...((((.((((((((((((((((((.(((((((((((((..........))))..)))))))))........((((.........))))((((((..(((((((((((............(((((.....)))))(((.(((((.((.......)).))))).)))....))))))))))).))))))..(((.((.((((......))))))))).....(((.((.(((((((.((((((..(((.(((.((((((((........(((..(.((((.(((........(((((((((.....(((((.(.(((((.((.((((((((..(((((....(((....((((((......))))))...))))))))..)))).....))))..)))).))).).)))))....))))))))).))).)))).).)))((((((((((.(((((((((((.(((..((((((.((((.(.(((((((.((((.((.....((((((((.(((..((((.((((((((.....))))).(((.((((((....)))))).))).(((((......)))))....((((..((((.(((.(((((......)))))))).)))).)))).(((((((((((((((.(((((((......(((.........)))..((.((((((((((.......))......))).))))).)).......(((((((........((((........)))))))))))((((((((............(((((....)))))...((((.((...(((((((.(.....).))))))))).)))).....((((((((.(((.((((((((((((.....)))))))....))))).......((((((......((((((((((((.......(((.....))).(((((((...((((.....))))))))))).(((((((..((.(((((((.....((.((((((((((..(((((((...(((.(((((((....(((.(((((((((((((.....((((.(((...((((((((((.(((.((.(((..(((((((..((((.((.((...)).))..))))..))..))..)))..)))..)))))..)))).))))))((.(((((((((....)))))))))))..))).))))..)))))))..)))..)))...)))....))))))))))(((..(.(((((..(((((.((((((((.((((((((((.......))))).))))))))).)).)))))))..(((((.(((((.((.((((((((((((((((......))))...(((....)))..((((((....(((((..........(((((....))))).)))))))))))...(((((((......)).)))))..((((((((....)).))))))......(((.(((((((.((((((((.......(((((..((((......((((((((((((.....(((((.((..(((((.((.....)).))))).(((((((((((((((....)))))))...(((...))))))))))).........)).)))))..)))))))))))).......(((((............(((((.............)))))...........))))).....)))).))))))))))))).))))))).)))(((((((((((((((((....((((((((((.(((.........(((((((....)).)))))(((((((..(((((........)))))..))))).))..))).)))))))......)))(((((......))))))))))))))))).))))).)))))))).)))).))))))))))))..........(((((((((((....(((((((.(((((.(((..(((..((((...)))).)))))).)))))..)))))))..)))))))))))))))).)..))).))))))))))))))..))).))..((((.....))))....)))))))...))....)).)))))(((((.....)))))..((((..((((.(((.....))).))))..)))))))))))).))))(((.((((......)))).)))...............))))))..))))).)))))).))))))))..............))))))))))...(((...((((((..(((.(((.(..((.((....)).))..).)))..)))(((((.((((...))))))))).....((((((((.....))).)))))..(((((((....)))))))......))))))...)))......)))))))))))).(((.(((........))).)))))).))))))).))))))))))))))))))))).).))))....((((((....))))))((((..((((.........(((((..........)))))......))))...))))))))))))).))))))))..))).)))).(((.((.(((((.((....)).)))))))...))).))))))......(((((((((((((.((((.(((((((.(((...))).)))).........)))...)))).)))(((((...))))).((.(((..(((((........)))))..))))))))))))))).((((((....)))))).))))))))..)))........)))..)))))).........(((((..((((((((.......))))))))))))).....))))))).))..)))....((((((...))))))..........)))))))))))))))))))))).))).((((((((((..(((......))).............))).))))))).......)))))))).))))).))))))))))))))))...))))))))....(((.((((........)))).)))....(((((((((((((........)))))))....))))))..((((((.((((((((((....((.((...(((..((((((.(((..(((.(((((......)))))...)))...)))))))))......((((((((...((((((((((.(......).)))).))))))...))))))))(((...((((((((((((((((.....((((((.....................))))))((.(((((((....)))))))..))((.(((((((...((((((.((((((..((((......(((((.((.((...)))))))))...))))...)))).))..))))))....))))).)).))..........((((((...))))))))))))))))))))))..)))........((((((((..(((......)))...)))))))).....)))...))))...)))))))).))..))))))...............))).....))))((((.....)))).(((((.....(((((.....)))))..)))))....
Thermodynamic Ensemble Prediction
.(((({{...,,(((((((.(({(((((((((,((,{(((,((.(({((((({({{{{|||,,,..,,.))||||.||(.((((,((((((((((.{,{{,{.,.((((.(((.(((.({...)).)))))).)))}.}}})),,)))))))}}}}})).}))))))...))))),.))))))|}},.,,((((({......))))))..{({({((.(((((((((((((({{..{,.({(..{.(((.((.(,......{{((((((..(((((((((((...,...,...{(((((.....)))))|{{.(((((.((.......)).))))).))}....))))))))))).)))))}})),..},,}}.}})}),.))).)..})))))))))..{,(({((((,{{{{{({.{{{,,{{,({((((((.....,.,((({.{,(((((((({.{{{...{{{{{|{||(({((((({..,.(,(({.(({((,(((,,..,,}}||}|||,|||,|((((((..,,,,}}}}})}}}}}))),,,..,{((,,,..,.|,,,||.....,||,||,,}}}},}}))}}}|},|{|.|||{.,...,||.(({(,(({(((,,(((((({((({{{({{,,.(({(.{.(((((((.(((,,((.....((((((((.(((|,|{((.((({((((,....))))).{({.((((({..,.}}||||,|||,(((((......)))))....{{{{..((((.(((.(((((......)))))))).)))),|}}}.(((((({(((((..{{(,,((({{{{.............,|||...}}),(((((((,,,((((({.((((.{,.({((((((((((((((..(((((((........{{{|.||...,.}}}})}}}|||(((,(({{............(((((,..,|||}|,,,((((,{{{(((,((((,..{{{{{{{,},,,,,,)})))))...,})).)))),))}||||}}|((((((.....))))))|,{|,.||,,.....}})}))}({{{{({((((..{(((.({{{...|{{...{{{{{{.(((,((({{(,,(({{...,,)))),((((((((((((...{.((((.((((((.((((.(((..(((((((((((....(((.(((((((....(((.(((((((((((((...,.((((.(((...((((((((((.(((.((.(((,{{{{((((..((((.((.{{...,}.})..))))..))..))..,))}}}))..)})))..)))),,)))))((.(((((((((....)))))))))))..))).)))).,)))))))..)))..)))...)))....))))))))))(((.....(((((,(((({{((((((((.((((((((((.......))))).))))))))).)).)))))))..,}.)))))....))).))})))))))))..))))))).)))))).)))).,....))))))).))))){|||.||,|.,,,{((((,,..|||||.|,|},||{|||,..(((((((......)).))))),,|}||}}}}|||||||,...,....})}}.,,)))),)}},,,.,,,...}}}||}}....},}},,.......,,,....||||,....,||,...))}.)))).)))))))}|||}}}.}||,{{{{(((((((....)))))))...{{{...))))))))))))))}}}))))},)),,,,}),)))),))))}}....,))))))...,,,|,.|||,,}..,,,,,,,},...}}},)),.....(((..((((((...((((.((((((((((.,,,..((((((.(((({.{........).)))))))))))))))))))))......{{{(((,((,..{{((...))}|.((((((.((((((((((...{.(((((((..(........)..)))))))}.((((.(((((......)))))))))((((((((((((((.......))).)))}}))))))).(((.(((.,.,(((((((((((((....(((((((.(((((.(((..,,({{((((...)))).)))))).)))))..)))))))..)))))))))))))).))},.))).)))))))))).)))))).......,,,......||||....)))})))))))})))).))))))..))}({{({{,...{{{((((..,((((({,.{{{{|||{||,{{{((,(({.(((((...))))),||,}}}}}..))))},,...............,|||||{,|,|||,.((((({{.{.{{{|,..(((.(((........)))...))).}))).)))))))){{{{(|{{|,.,|||,{{{{..{{,,,|,.|)|,}}}|)))}}},|}|}}..))))}))...,}}||||((((((({.{{..,,,,,..(((((((....))))))).,,}}}))))},})})))),))).)))))))))))).||{,|||{{{{...}))).}},))),))))))).))))))))))))))))))))).}.)))),|,{((((((....)))))))|{{...|||,,{||,..}||||||},.,,,,}})),)),}}},},}))}}})}}))))))}}.}}))).}.}}}}|||{|.,,|((..{(.(((((.({....)).))))))),}|},,.}))}},..,,,,(((((((((((((,(((|.{({((((.(((...))).)))).........))}...}}))})))}{{{{..,||}|{,((.(((..(((((........)))))..))))))))))))))),(((,,,.,}})))))),)))))))}},))}},....,,)))}}}}|||}.,.}}.,..((({,.,(((((({{.......,,))))))))))},.,..}}}}})),,,..||,,||||{|||||,,||..,.}},}}},},}))))))).,))))),))))))).))))..)).))))))))))))))))))..|||,,|,{{{,....,}||||{{{((({,{{{|(((,((((((,......{((......))))))))).)))},,..,,,||||}}},,,|.}},,.,},....{((((((((((((.,.....,))))))))...}))))}.,{(({({.{{{{|{{|||,...{,.,{,,.,,,,,||{|||,,{{,.{((,{{(((,.....|||||,||}}|...))}))}))).,,||,{(((((((...((((((((((.{......}.)))},))))))...))))))))|||,,,||{{{{{{{{{{{{{{..|,|((,(({{.,,.....,}}|||},||,||,,.,{{,.(((((((....)))))))..)),)),.{||{{...|||{({|{{||||..,|||,..,..{{{||,||.{(...||||}}}}|{{.,|||{{,,,}}})))})}})))....))))}.||{.......,}}..((((({...}))))),}}}}}}}}}}}||||..,,,..,,,,,,{(((((((..(((......)))...)))))))}......,,...}}))...,))))}))})),.,}||||,,,.,{{{{{{....,.,..,,,||{(((((.....))))})},.})}}}}}|{,,.....}}}}}..,,,}}}}..

Transcripts

ID Sequence Length GC content
CGGCUCCUCUCAGCGGCGGUGGCCCAGGUAGAGGGGUCCGCGCUGGCGG… 1758 nt 0.6155
CGGCUCCUCUCAGCGGCGGUGGCCCAGGUAGAGGGGUCCGCGCUGGCGG… 3785 nt 0.6188
Summary

This gene encodes a member of the calcium/calmodulin-dependent protein kinases (CAMK) Ser/Thr protein kinase family, which belongs to the protein kinase superfamily. This protein contains conserved DLG (asp-leu-gly) and ENIL (glu-asn-ile-leu) motifs, and an N-terminal polybasic region which binds importin A and the translation factor scaffold protein eukaryotic initiation factor 4G (eIF4G). This protein is one of the downstream kinases activated by mitogen-activated protein (MAP) kinases. It phosphorylates the eukaryotic initiation factor 4E (eIF4E), thus playing important roles in the initiation of mRNA translation, oncogenic transformation and malignant cell proliferation. In addition to eIF4E, this protein also interacts with von Hippel-Lindau tumor suppressor (VHL), ring-box 1 (Rbx1) and Cullin2 (Cul2), which are all components of the CBC(VHL) ubiquitin ligase E3 complex. Multiple alternatively spliced transcript variants have been found, but the full-length nature and biological activity of only two variants are determined. These two variants encode distinct isoforms which differ in activity and regulation, and in subcellular localization. [provided by RefSeq, Aug 2011]

Forensic Context

A study in humans demonstrated that the MKNK2 mRNA exhibits rhythmic expression with peak levels between 12:00 h and 18:00 h. This rhythmic pattern was utilized alongside other mRNAs to construct a k-nearest neighbor regression model for estimating bloodstain deposition time within a 24-hour cycle, achieving a mean absolute error of 3.92 hours [Cheng et al. DOI:10.1016/J.Fsigen.2023.102910]. Furthermore, the MKNK2 has been established as a previously validated biomarker for trace deposition timing and was integrated into a combined model with metabolites and hormones, contributing to high prediction accuracies with AUC values up to 0.96 for specific time categories [Lech et al. DOI:10.07/s00414-017-1638-y]. A study in rats demonstrated that the MKNK2 was significantly altered in expression on day 1 following a 20% total body surface area burn injury, as part of a comprehensive analysis of hepatic gene expression changes [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. This finding was identified within a broader set of 740 significantly altered genes, where the MKNK2 was classified under signaling pathways involved in the inflammatory response to the injury.