| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUAUUGGAGCAGCAAGAGGCUGGGAAGCCAUCACUUACCUUGCACUGAG… | 1819 nt | 0.4283 | |
| AUAUUGGAGCAGCAAGAGGCUGGGAAGCCAUCACUUACCUUGCACUGAG… | 1971 nt | 0.4333 |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down the interstitial collagens, including types I, II, and III. The gene is part of a cluster of MMP genes on chromosome 11. Mutations in this gene are associated with chronic obstructive pulmonary disease (COPD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
A study in humans and rats demonstrated that ultraviolet-B (UVB) irradiation induces significant transcriptional changes in skin, with MMP1 being highly up-regulated in human skin (fold change 188.1) and also up-regulated in rat skin (fold change 12.1) at the peak of hyperalgesia [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a porcine model of alcohol-induced liver fibrosis, transcriptional profiling similarly identified MMP1 as up-regulated in fibrotic livers, where it is implicated in fibrosis breakdown and hepatocyte proliferation [Yasmin et al. DOI:10.1016/J.Biochi.2020.12.022].