Basic Information

Symbol
MMP10
RNA class
mRNA
Alias
Matrix Metallopeptidase 10 STMY2 Matrix Metalloproteinase 10 (Stromelysin 2) Matrix Metalloproteinase-10 Stromelysin-2 MMP-10 SL-2 Matrix Metalloprotease 10 Stromelysin 2 EC 3.4.24.22 Transin 2 Transin-2 EC 3.4.24
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Wound age identification

MANE select

Transcript ID
NM_002425.3
Sequence length
1759.0 nt
GC content
0.4372

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-509.00 kcal/mol
Thermodynamic ensemble
Free energy: -544.79 kcal/mol
Frequency: 0.0000
Diversity: 486.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((((....((.((((((..((((((........))))))..))))))..))....)))))))..(.((((((((((........).))))))))))....(((((((..(((.....)))..((((...))))...............((((.(((.....))).)))).(((((((((...(((((.(((....(((((((........((((((((((((......))))))))))))(.((((((..((((..(((((....((((.(((....((((((((((.(((.(((...((((((..((((....))))....))))))...)))))).)))....((((.(.....)))))(((.(((((.((.....((((((.(((.((..(((....)))..)).)))))))))..))...(((....)))....(((((((..((((((((......)))).)))))))))))))))))))..((((((.(..........((((((.((((((.((((((((.(((((((...(((((((((((((((((((.......(((....)))...((....))....(((((..(((.(((...(((..........(((((((...((.(((.((((......(((((((.....(((((((((((((....((((...((((.((....))))))..))))..))).))))((((.(((((((.((....................)))))))))....))))...(((.((((((......)))))).))).....((((......)))).................))))))....)))))))......))))(((((...(((((((.....(((.((.((((........)))).))((((((((((.....))).)).)))))(((((((((((((.......))))))))))))))))..)))))))...))))).)))..))....))))))))))..))).)))...))))).....((((.......))))(((((.............)))))((....))....((((((((...)))))))))))))))))))))))))))...))))).......((....)).(((((((((((((((.(((((((..((((........(((((..(.((.(((((((((((....(((.(((((((........))))))).....((((......(((..((((.....))))..)))))))..(((((...)))))))))))..)))))))))).).))))).))))..))))))).))..((((((........))))))(((((...((((((.....))))))..))).))......((((..((((..((((((.(..(((((.(((.((((....))))...).)))))))..).)).)))).....))))..))))...)))))))))))))........(((((((((......)))).)))))..(((((...)))))........)).)))))))).)))))).))))))).))))))((((....))))..)))))))..))).)))))))))..)))))))))).)......((((((((((.................))).))))))).)))))))...))).))))).))))).))))....)))))))((((((....)))))).)))))..........
Thermodynamic Ensemble Prediction
.,..(((({(((((({....{(((((((({{({{{{,..{,{{{{}}}})),|}}}}}}}})},,},))))}}}..,.(({(((((({,.......).}))))))))}....{{({{{{,,|||...,{|||,|||((||,|,,,,,,{{{{,...||..{(((.(((.....))).)))}..||..||||}.,{{{..{(((({..{{{{||||,|,....((((((((((((......)))))))))))){.,((((.{{({,,..|,.,.},}}|,|||||{({{{((({((((((.({{{(((,,.((((((,.((((....)))}...,||}}}}.,.}}}))}.}}}....((((.{.....}))))|{{,{{,,,.,,..}}}|{{|||.,{,,|||,{||..,,)))},)),))))}}))),.,,.{{{{{,...}))}..,((((((({,{{{{((({.....,)))).)))})))))))}}}}}.})}}||||||,|.....,,,,,{(((({.((((((.((((((((.(((((((...(((((((((((((((((((...,,..(((....)))..,,,...{(,.,{{((((({{(((.((.{({(((....,{{{{{({{(({....((.{,,,(((({{{...(((((((.....(((((((((({{(....{(((...((((.{.....}})})}..}))}..))),,}}),{{{,{((((((,((................,...}}))))))).,,,,))},,.(((.((((((......)))))).))).....(({{......|)}}........,,.......))))))....)))))))......,,|.(((((...(((((((....,((({{{.(((({......,)))).)|((((((((((.....))).)).)))))|(((((((((((({{....})))))))))))))))),.)))))))...))))).,,|,....,,,,|}}},,,)),,}})})))}}},}}))....,||||}}},...))))}|||,}}},,,}})}}..}}}))))..,.,|,,{{(({{{,,,...})))))),)))))))))))))))))))...))))).......((,...}}.(((((((((((((((.(((((((..((((........(((((.,{.{{.((((((((((({...,{{.(((((((........))))))).,.,,{{,,....{((((..((((.....))))..)))))},..(((((...)))))),}})}..))))))))}),}.))))).))))..))))))).)),.((((((,,...,,,)))))){{{{,...((((((.....))))))..}}}.},...,,.((((..((((..((((((.(..(((((.((,.{,({....,}))...,.)))))))..).)).)))}...,.))))..))))...}))))))))))))......,||,{({{{{{......,}}},,)))),.(((({...}))))........)).)))))))).)))))).})))))|{|}}|,{((((....))))).),,)))|{{{{|{|}},,,,,,,}))))}))}}||||,....((((((((((..............,..))).))))))).,}|||||,..,}}.,)))),},,,}}))}},})))))))),{(((({....}))))}.)))))....}}....

Transcripts

ID Sequence Length GC content
AGAAGCCCAGUAGACAAAGAAGGUAAGGGCAGUGAGAAUGAUGCAUCUU… 1759 nt 0.4372
Summary

This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down fibronectin, laminin, elastin, proteoglycan core protein, gelatins, and several types of collagen. The gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]

Forensic Context

A study in humans demonstrated that the MMP10 is commonly reported as a specific marker for the identification of menstrual fluid, though it has also been detected in other body fluids including semen, vaginal fluid, and saliva [Holtkötter et al. DOI:10.1007/s00414-014-1097-7]. An experimental study in rats mentioned the MMP10 as a stromelysin protein vital for normal cellular proliferation and wound contraction during the wound healing process [Ali et al. DOI:10.3390/biomedicines10112919]. A study in humans developed a heptaplex mRNA profiling method for distinguishing menstrual from peripheral blood, which mentioned the MMP10 as a previously described marker for menstrual blood [Jakubowska et al. DOI:10.1016/j.fsigen.2014.07.006].