| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGCCCAGUAGACAAAGAAGGUAAGGGCAGUGAGAAUGAUGCAUCUU… | 1759 nt | 0.4372 |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down fibronectin, laminin, elastin, proteoglycan core protein, gelatins, and several types of collagen. The gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
A study in humans demonstrated that the MMP10 is commonly reported as a specific marker for the identification of menstrual fluid, though it has also been detected in other body fluids including semen, vaginal fluid, and saliva [Holtkötter et al. DOI:10.1007/s00414-014-1097-7]. An experimental study in rats mentioned the MMP10 as a stromelysin protein vital for normal cellular proliferation and wound contraction during the wound healing process [Ali et al. DOI:10.3390/biomedicines10112919]. A study in humans developed a heptaplex mRNA profiling method for distinguishing menstrual from peripheral blood, which mentioned the MMP10 as a previously described marker for menstrual blood [Jakubowska et al. DOI:10.1016/j.fsigen.2014.07.006].