| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGCCCAGCAGCCCCGGGGCGGAUGGCUCCGGCCGCCUGGCUCCGCAGC… | 2261 nt | 0.6192 |
Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the enzyme encoded by this gene is activated intracellularly by furin within the constitutive secretory pathway. Also in contrast to other MMP's, this enzyme cleaves alpha 1-proteinase inhibitor but weakly degrades structural proteins of the extracellular matrix. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the MMP11 mRNA is a specific marker for menstrual blood, detected in 95% of menstrual blood samples and expressed in menstrual blood but not in traumatic peripheral blood [Jakubowska et al. DOI:10.1016/j.fsigen.2014.07.006]. The MMP11 transcript, part of the matrix metalloproteinase family involved in endometrial tissue remodeling, can be sensitively amplified using molecular methods like multiplex PCR and NASBA for forensic discrimination, though markers with shorter amplicons like MMP7 may offer greater stability in aged stains [Counsil & McKillip DOI:10.2478/s11756-010-0001-2]. A study in humans demonstrated that the MMP11 mRNA is a highly sensitive and specific marker for identifying menstrual blood in forensic samples, as part of an MMP triplex (with MMP7 and MMP10) it was reliably detected in dried stains by 24 participating laboratories [Haas et al. DOI:10.1016/j.fsigen.2013.09.009].