| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAAGGAACACAGUAAACUGAAUUGAUCCGUUUAGAAGUUUACAAUGA… | 1822 nt | 0.3891 |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease degrades soluble and insoluble elastin. This gene may play a role in aneurysm formation and mutations in this gene are associated with lung function and chronic obstructive pulmonary disease (COPD). This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
A review of human studies found that the MMP12 is a top protein associated with aging in plasma SOMAscan analysis [Solovev et al. DOI:10.1016/j.mad.2019.111192]. In a rat model of spinal cord contusion injury, the gene encoding the MMP12 was strongly up-regulated at 1 day post-lesion, indicating its role in ECM remodeling during the active lesion phase [Bighinati et al. DOI:10.3390/ijms22041744]. A study in mice demonstrated that the MMP12 gene, identified as an early marker of paraquat-induced pulmonary injury, showed a significant increase (>2-fold) at 6 hours post-exposure [Tomita et al. DOI:10.1016/J.Tox.2006.12.005].