Basic Information

Symbol
MMP12
RNA class
mRNA
Alias
Matrix Metallopeptidase 12 HME Matrix Metalloproteinase 12 (Macrophage Elastase) Macrophage Metalloelastase Macrophage Elastase EC 3.4.24.65 MMP-12 MME ME Matrix Metallopeptidase 12 (Macrophage Elastase) Matrix Metalloproteinase-12 EC 3.4.24
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis Sudden death from CNS diseases Sudden death from respiratory system disease

MANE select

Transcript ID
NM_002426.6
Sequence length
1822.0 nt
GC content
0.3891

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-428.00 kcal/mol
Thermodynamic ensemble
Free energy: -469.24 kcal/mol
Frequency: 0.0000
Diversity: 550.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((.(((((((((((...((((.....)))).)))))))...((((...)))).....((((....)))).(((..((((.(((((((.(((....))).))))))).)))).)))..........)))).(((((......)))))..(((((...((((.(((((((.............(((((.((..............)).)))))......((((((.......(((((((.((...)).)))))))(((.......)))(((((((.((((((.........(.((((((.((((....((((.((((((.((((((..((.....((((((...)))))).)).)))))))))))).)))).((((((((.(((..(((...............((((((.((.......)).))).)))..............((((....))))..)))))).))))))))..((((((.((..((((.........((.(((((((((((..((((((....((((((((.((.(((..((((((....))))))..))).))))))))))))))))..))).)))))))).)).........))))..)).)))))).)))))))))).).(((((((((...(((((((.(((..(((((((.(((....))).)))).))).)))((((.(((.((((((..((...))...)))))).))).))))..((((((((((...(((...((((...((((.(((((....))))).))))....(((((..((.(..((((((.(((.....).)).))))))..)...))..)))))..................(((((((((..(((((((((....(((((....(((........)))...)))))...((((((....((((......)))).((((((((.(..((((((((...((((((((((((....((..((((.....................(((((.......)))))))))..))....)).)))).))))))..))))))))(((((.((((((........(((((......((((((..............)))))).......)))))(((((((........)))))))...............))))))..)))))..).))))))))..))))))............((((......)))).....((((.((((.((((((.((..(((((((.((((((........)))))).....((((((.((..(......)..))))))))................)))))))...............................((((......................))))....)).)))))).))))...)))).........))))))))))))))))))....)))).)))..)))))))))).))))))).)))(((..((((.(((.....))).)))).)))..))))))((((...))))..((((((.(((((((.(((........((((((.....))))))........)))...)))))))....((((((....)))))))))))).))))))...))))))).....((((((.........))))))..))))))))))))).)))).)))))...((((((.(((.....)))))))))......))))).((((((((...((((((((.((.(((.....))).)).))))))))....)))))).))....................
Thermodynamic Ensemble Prediction
.,.(((((,{.,,(((((((...{,{,.....)}},.)))))))..,|,{||}|)))}|....((((....)))).(((..((((.(((((((.(((....))).))))))).)))).)))...........,,,.{{{{{,{,...}}}}},,{((({...((((.((((((({{{.....,....{((((.({..............}}.)))}|,{{{,,((,,((,....,,(((((((.((...}}.)))))))||{.....,,|}|((({{{{,{(({{||,,...(((({{((((((((.(((,..{((,.....}}}....}).))).)))))))))))))..,,|.(((((((((..((((((.(({{(((((((....(((...,.............((((((.((.......)).))).)))||.........(((((((..{..(((...({(,(({.,{((({{.((((((.((..,{{({.{{{{{..((.(((((((((((..{{{{{{.,..{{(((((({((.(((..((((((....))))))..))).)))))))))}}})))}..)))}}})))))).))......}}}))})}.)).)))))).,),)}))))).))}.))).}..)))))))....,{{..(((((((.(((....))).)))).))).}}}((((.(((.((((((..{(...})...)))))).))).)))).....)))..)))))))))))))..})){(((.(((((....))))).)))}.))))))))){(({.{{((((,{,(((,....|{||{,,,.|)|.}}},},..,|{|{{{{,.....|||||....((((((({{{{(((((((((....((({{..{,,,,.,.,,.,,)}},..))))}...{(((((,...{{((...,,.}}}},{{{{|{{(|{,|{{{(((((,,.((((((,,,|||}}}.,|{{({{({{{{,,,,,....,,..,,..,((((.......))))|{{||{.{{,{{.,|.|....},,,)).}))))))}.,{{{.,({{{((({,,.,,}}|,},|.,|||{(((({,.,,,,....,,,,}}}}}|||,,........(((((((........))))))),,|{{{,,....|}.}}}}||,||,|,,..,.}})))))}..}}))))......,}}},.((((......)))).,,,,||||,|{{{.{{{{{{.{|,,|({{{|{.{{||||{(.,,{{{||,|||.....,,|||,}||,.|....||,..})))}}))},,....,}},,,}}.)))))}}...........,{{{,....,||||,,....{|||,,....,....,}.....,...})}}....}}.)))))).}})}...}}}}....,,...)))))))))))))))))),,,}})}|,|,,...|}}}}}}||||||||..,,,,}|||,||||}{|{.,.,,}||{}|,,})}}})))).)))|,(,...,,}}}{(((((.(((((((.,{{..,,{...((((((.....))))))...,,}}.},}...))))))}....{(((((....)))))})))))}.}))))}...}))}})),.,}},,}})))))),.,,....,))}.,,)))}))))))).}))).))))}...((((((.(((.....)))))))))......}}})}|{.{(((({.,,((((((((.{{.(((.....))).}}.))))))))..,.)))))),|||,......,,,.........

Transcripts

ID Sequence Length GC content
AGAAAGGAACACAGUAAACUGAAUUGAUCCGUUUAGAAGUUUACAAUGA… 1822 nt 0.3891
Summary

This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease degrades soluble and insoluble elastin. This gene may play a role in aneurysm formation and mutations in this gene are associated with lung function and chronic obstructive pulmonary disease (COPD). This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]

Forensic Context

A review of human studies found that the MMP12 is a top protein associated with aging in plasma SOMAscan analysis [Solovev et al. DOI:10.1016/j.mad.2019.111192]. In a rat model of spinal cord contusion injury, the gene encoding the MMP12 was strongly up-regulated at 1 day post-lesion, indicating its role in ECM remodeling during the active lesion phase [Bighinati et al. DOI:10.3390/ijms22041744]. A study in mice demonstrated that the MMP12 gene, identified as an early marker of paraquat-induced pulmonary injury, showed a significant increase (>2-fold) at 6 hours post-exposure [Tomita et al. DOI:10.1016/J.Tox.2006.12.005].