| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACAGUCCCCAGGCAUCACCAUUCAAGAUGCAUCCAGGGGUCCUGGCUG… | 2714 nt | 0.3891 |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease cleaves type II collagen more efficiently than types I and III. It may be involved in articular cartilage turnover and cartilage pathophysiology associated with osteoarthritis. Mutations in this gene are associated with metaphyseal anadysplasia. This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
A study in mice demonstrated that cryolesion-induced traumatic brain injury up-regulated the MMP13 at 24 hours postlesion, but no significant differences in its induction were observed between wild-type and tumor necrosis factor receptor 1 knockout mice [Quintana et al. DOI:10.1002/jnr.20680]. In human skin wound healing, cross-species single-cell analysis identified the MMP13 as a matrix metalloproteinase with a mouse-specific proteolytic role, functionally analogous to human MMP1 during re-epithelialization [Liu et al. DOI:10.1016/j.stem.2024.11.013].