Basic Information

Symbol
MMP14
RNA class
mRNA
Alias
Matrix Metallopeptidase 14 MT1-MMP Matrix Metallopeptidase 14 (Membrane-Inserted) Membrane-Type-1 Matrix Metalloproteinase Membrane Type 1 Metalloprotease Matrix Metalloproteinase-14 EC 3.4.24.80 MT-MMP 1 MMP-14 MMP-X1 MT1MMP MTMMP1 Matrix Metalloproteinase 14 (Membrane-Inserted) Membrane Type 1-Matrix Metalloproteinase Membrane-Type Matrix Metalloproteinase 1 EC 3.4.24 MT-MMP WNCHRS
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_004995.4
Sequence length
3701.0 nt
GC content
0.5890

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1550.40 kcal/mol
Thermodynamic ensemble
Free energy: -1617.56 kcal/mol
Frequency: 0.0000
Diversity: 1261.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((.(((.((...(((((((((.(((((....((((.(((..(((((((..((((...(((.((((........((.((((((.....(((.(((((....))).)).))).............((((...........))))((((((.(((.((.((...)).))))).(((((((((((((....))).))))))...))))((..(((...((((((...)))))))))..))(((((...(((((((((..(((.(((.((((.(.(((((.(.(((.((......((((((((((..(((...)))..((((....)))).(((((((..(((((((((........))))))(((((((((.(((.((....)).))).......((.((((((((((((((((((((.(((....((((((.((((..((((((...(((((.......)))))))))))..))))..((((((...((((.(((...(((((.(((.((..........)).))).))))).....))).))))......((((((..(.(((.((((((..(((.((((....(((((....((((..((...(((((....)))))...((((.....))))(((......)))........((((.(((.((.(((.(((((.(((((((..((((......))))(((((((...)))))))......))))))).)).))).))).)).)))...))))))..))))........))))))))).)))..))))))..))).)..))))))))))))..))))))...(((((((..((((.((((((.((((((.....(((.(......))))....((.(((.(((((.(((((((((..((.(((((((((((.....((.......((((((((((((((..(((.(((((((((...))))...)))))(((((.....((((((((...((((...))))...(((((((((((((((((((((((((...............((.((((...(((((((((..............(((((((.((((((((................((((((.....((.((((((..((((.(((((((..(((.....(((....((((.....((((.....(((((((.((.((...(((.((.(((((((((((((((..(((((.(....).)))))..)))))).)))))...)))))).))).....))..)).)))))))....)))).((((((((((((.(((((...((((..(((.(((((((......(((((((..(((..((((((.(((......)))))))))..((((((..((((((((.((((.....(((((.((((.(..(((((((.((..((.....))..))))))))).).)))).)))))...))))...))))))))..)))))).(((....)))..((.....))...((((((.((.(((((..........))))).))))))))))).))))))))))).))).))))))).))))).......((((((((((....))).....))))))).)))))...))))))).....(((((........))))).....)))).........)))....)))..)).))))))))).))))))..))(((((((.....)).)))))))))))....((((((...))))))((((((((((((.....(((((((.(((((((.((.((((((..(((....))).((((..((((.((((..((((((((((((((((((.((((.(((...))))).)).))))).)))...((.(((((((((((((....(((.(((......(((.((((.((((...)))))))).)))......((((((((.....)))))).))))).)))..)))))))))))))))(((((((((((((((..(....(((((.(((.....))).))))))..))))))).))))))))......)))))))))).)))))))).)))).)))))))).)))).))).)))))))))))))))))))..)))))))))))))))........)))))))))....)))).)).....(((((((((((((((((.(((((((((((....))))))))..))).).)))))))))))..)))))..)))))))))))))(((......)))...((.(((((((.(((((........))))).)))))))))..))))))))))))......)))))))).)))))..((((((((((((.((((..((((..(((((..(((..((((..((.((((..((((......))))....))))))))))....((....)).((((................))))...((((......))))...)))..)))))....))))...)))).)))))))))))).)))..)))))))..........)))))))....)).....))))))))))).)))))))...))))...))))))))))....((((((.(((.((((((((((..(((((......))))...)..)).))))))..)).)))))))))....((((((((((((..(((((((((....((..((((((....))))))..))(((((.....))))).....))))))))))))))))...))))))))))).).)))))))))..))))))).)))))))))))).((((((.(((....(((.......)))))).....)))))).))))))).)))))).....(((......)))...)))))))))(((((((.............((((((((((....))))((...((((..((((((.....)).)))).))))...))(((((((((((((((((.((((....(((((((......)))))))....))))))))).)))).))))))))))))))(((((....)))))((((..(((..((((.(((............(((((((((.((((.(((.....(((..(((((((((((....))))))....((((.....))))..((.((((((((((((((..(((....)))..))))))..))))))))..))....(((((..(((........)))..)))))...)))))..))).........)))))))...)))).))))))))))))..)))..))))....)))))))..((((((((....))))))))..)))..))))).)).))))).))))).....)).))))))))).).))))))))))..)))))))))))))).))))))))))))..))........)))))))...))))..))...))))).))).))))...))))).)))))))))(((((((................))))))).....((((.......(((((((.........))))))))))))).))).)))))(((((((((.(((((((.(((((((.((...(((((...))))).))))))))))).)))))..((((((........))))))..)))))))))...........((((...))))
Thermodynamic Ensemble Prediction
...(((((.(((.((...(((((((((.(({{{....,,,(,{{{..,{{||{(,,((((,,,{(((((((,,{{((,....,}}}||,....(((.(((((....))).)).))).,,.,,,...})))))|............,{(((((({.,,,.,|}}.}}})).,,,(({((((((((((((((((,|||{((({,|,..||({((..,.,}}}|{((((...))))},{.{{{(,(((((..,{,{,{{((,{{(((((((.(((((({((({,...|,,,||.(((.(((.(((((((..(((.,((((({........((((.(((((((..((.(((((.((((.....(((.....}}}....(((,{(....)}.)))...{{{{((.,,((((,(((((.{(({({(((((....))))}..((((..((((((...(((((.......)))))))))))..)))){{({,{{,.,{(((,....((((....{((.((((((((((...(((..{((((((({.({...((((..{{(..{..{(((((((((.(((((({.((({(,((,.{{(,,..}}}..}|,.......{((((....))))}...((((.....))))(((,.,,.,|}}.||||.,.|||{.{(({(.{(((((...{.((((((.......))))))}...)))))}..)))))},)}}}}}}}|||.|...,|||,}|((({((.{{{{|,|||},.,.,..,,....,..,})})},}}}))))))))))}..||}.||||||,,}}}})}),,))))))))))),|,.}},)))}...}}.}}}}))))))..)))..}}},,)}})})).)))..,,}}}},,)}}}}|},,})}},|,,,,|||||,|}}...{{{{......,,}))),))}}))}))),....))))|)))).))..})))))).))))..{(((((...((((({((({...}))).((((((.....(((((.(.....((((,.{({{{(((((((({{(((((((({(,{(({{{{||,|,..,,,...((((({(,{(((((({((({..,..,{{{{..,{{{{,..,{{(({{{,{{,.,,|{,,,,,,((({{({..............(((,....}))).....||,,,,|,.})))))),,,,}|.{{{.{((((((((((..(((((.(....}.)))))..)))))).))))).}}),}}||}}}}.....}}..,{({{{({((.,...,||..((((.,,,((({...,}))}|||}}.||,.|,|}||}}}},.||||{{{{..,{((((((((((({.....}))))))))))..{(((((..((((((({.((((.{...(((((.((((,(..(((((((.((..{{.....}}..))))))))),).)))).)))))...))))...})))))))..)))))),|||,,,,)),.,((......,...,{(((||({.(((((..........))))).)))))))||||.|||}}}}}},,.}},.,}.,|||.|||,|......})})})}..||,,.}))))},}}))))})},))))),,)))))))))).}}})}}))))).....).)))))))))))........((((...........)))).,,|||..(({,,.,))((((({{.....)).)))))}))))))))))}}))))})))}...))))))).})))))...})))),..})).))}}))))}.)).}.,|.{{{{||{{((((.,{((({(((({{((({(((({{((((({((.{{{|,{||,,,,}))),}),))))),}))},,((.(((((((((((((...,(((,({{......{((.((((.((((...)))))))).)))......{(((((((.....}))))).))})).)))..)))))))))))))))(((((((((((((((..,..,,(((((.(((.....))).))))),..))))))).))))))))......,}||||}}}|,||||||||,||||.|||||,,{(((|,(|(((|||||(((((((.(({|||,.,((((..{(|(|{||,{((((((((((((|{{...,}{{{{.....))}}.((((((((((((((.(((((((((((....))))))))..))).))))))))))))},)){|||.,((((||((((|||((((((((.(((..((.((({(((((((((.{(({{..{(({{{((((|||(((((.....,...)))))....))))))..)))))(({((((((((((((.,,,,{{(({,.,{(((({.,.((({((({.((.((((({((((......)))){{{{{(((((((((,..,,,..,,(((({{({{,{,{,.{{{,{,({{,{{...{((,.,,,..|||{.,,.|||||}}}.,}))).}),})),,}}))}})}}||||.|||||||||}}}},.....,{{{|||{||....,,|,,,{.|||||||{|,,{||..,.,,,.,.))}....))))))))}..}||||{{.{{{,|,{{{{|||{..{{(((,,,{..}}},...|,,}|,|}}}}}..||,}}))}}}}}.,...||}))))|||)))|||||}|||.}..,|},,|||||,,,,))))))}})),,,,,...}})))),...}),))))),))),,})))))})))))))))..})))))))))),.})))))))}))))}||||||{.(((,...))))}).|,|.......}}},))).}}).))..))).))))))))}))).,,,))))).,,.,)))...,))))))))))))}.((.....)).....(((((({(((....)))}{{,..((((..((((,{,..,,)).)))).}}))...},(((((((((((((((((.((((....(((((((......)))))))....))))))))).)))),,)))))))))))))(((((....)))))}|))))))}.)))}|})).))))))).}...))}|))}})}})))}.......}|}}..|||}}|||||,|||||{((({,,,(((({,{({,||||..,,,||,||))))|||||.}||}}}}})))}))))),))})}))))))))))...)))))))))))))}..,))))){(((((((((,,{{|..{{|,{{{{,{{.(((.((((((((((((|{{((|{.{{|.{({(..{({({{,,(((((({,.((((((((....))))))))..,...,{|}}},}))})}.),),))),).)})))).,)),))..).)),),)))).}.)))))))))))).))),,))).)))),..}))}.}}}..)))))))))}}))),,))..,})})),))).))))},,))))).))))))))){((((((...,,.....,,....))))))}{{{,...||}}.....(((((((,,.....,.))))))),}}})).))).)))))(((((((((.(((((((.((((((({((...(((((...))))).)))))))))))))))))..((((((........))))))..)))))))))...........,({{...))),

Transcripts

ID Sequence Length GC content
AGACCCCAGUUCGCCGACUAAGCAGAAGAAAGAUCAAAAACCGGAAAAG… 3701 nt 0.5890
Summary

Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily; each member of this subfamily contains a potential transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. This protein activates MMP2 protein, and this activity may be involved in tumor invasion. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that matrix metalloproteinase 14 (MMP14) is a membrane-bound protein present in the cell membrane of epithelial and stromal cells of the endometrium in menstrual blood but absent in peripheral blood, as detected via immunocytochemical staining [Gray et al. DOI:10.1016/j.forsciint.2012.01.020]. This differential presence provides a basis for developing immunoassay techniques to distinguish menstrual from peripheral blood in forensic contexts.