| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAAGGAGGCAGGCAAGACAGCAAGGCAUAGAGACAACAUAGAGCUAAG… | 1822 nt | 0.4495 |
Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades fibronectin, laminin, collagens III, IV, IX, and X, and cartilage proteoglycans. The enzyme is thought to be involved in wound repair, progression of atherosclerosis, and tumor initiation. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the MMP3 mRNA is a highly specific marker for menstrual fluid identification, with the highest specificity (76.7%) among tested markers and detection significantly associated with menstruation, though it was less abundant in samples from some hormonal contraceptive users [Albani et al. DOI:10.1016/J.Fsigen.2020.102359]. A subsequent human study developed an RT-LAMP-CRISPR assay for the MMP3 mRNA, confirming its detection in menstrual fluid but noting it was also detected in some rectal mucosa samples, indicating potential cross-reactivity in this novel isothermal amplification method [Lynch et al. DOI:10.1016/j.fsigen.2024.103167]. Its transcript levels were less abundant in menstrual fluid samples from some hormonal contraceptive users, and it was also found to be up-regulated in human and rat skin following ultraviolet-B-induced inflammation, with a fold change of 81.5 in human skin [Dawes et al. DOI:10.1371/journal.pone.0093338].