Basic Information

Symbol
MMP7
RNA class
mRNA
Alias
Matrix Metallopeptidase 7 Matrilysin PUMP-1 MPSL1 Matrix Metalloproteinase 7 (Matrilysin, Uterine) Matrix Metalloproteinase-7 Uterine Metalloproteinase Pump-1 Protease Matrin MMP-7 Matrix Metallopeptidase 7 (Matrilysin, Uterine) Uterine Matrilysin EC 3.4.24.23 EC 3.4.24 PUMP1
Location (GRCh38)
11:102520508-102530853
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002423.5
Sequence length
1119.0 nt
GC content
0.4334

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-313.30 kcal/mol
Thermodynamic ensemble
Free energy: -337.87 kcal/mol
Frequency: 0.0000
Diversity: 284.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((..(((((.(((((((((.......))).))))).(((((...(((......))))))))(((.(((((((((.((((((((((((..(((...))))))))).....)))))).)))).((((((((((...((....)).))))))........(((((((((...)))))).)))))))...........((((.((((((((((.(((....((((((((.(.....).))))))))...........(((.((((((..(((((.(((((......................))))))))))....)))))).)))........(((((....))))).(((...(((....)))...)))........((..(((...........)))..))..((((........))))...(((....)))...)))))))))).)))..))))..((.(((((((((((.....((((((((..(((((((.((.(..(((((((.........((((..((((..(((.(((((.(((((((((...((..(((((((.....(((((((((((.((((...(((((...))))).(((((((((...))).)))))).))))))))..))))).)).(((((.(((((...((((......))))....))))).)).)))...)))))))..))..)))))..))))...))))))))))))..))))))))))).((((.....))))...).)).)))))).....)..))))))))..((((((.....(((((((((((((((((.(((((....(((((..(((............)))))))).((..(((((((((.............)))))(((.(((((...(((......)))...))))).)))..))))..))..)))))...(((((................)))))...)))))))))))))))))((((.((....(((((.....)))))...)).))))...........)))))).....))))).)))..))).))..........)))))))).((((((((...))))))))).)))))..)))).
Thermodynamic Ensemble Prediction
...{{({..(((((.{(((((((({(....))}),))))).(((((.,|({(,,....|}}}||}||,|||||((((((.((((((((((((..(((...))))))))).....)))))).)))))}{(((((({({{{((,....},||}}}|{{...,{{((,((((((...)))))).,,,...............((((.((((((((((((((....,{.,{{{{,({{{{...,|||||{{{,,.,{,{{{.((({,,,(({..,{(,,,((((,.,.....,.,,}}.,.,},}}}),)))))))}}}}})),,))}))|........((({{....,}}}}.(({...|||...,||,..{|||....}}},,|},{{(,,,....,,,.}||..||..((((........))))...{{{.,,,}))...)))))))))).)))..))))..||}||{|{||||(({{{..((((((((..{((((((.((.(,.(((((({,.,||||,..((((((((.((..(((((........))))}...(((((((((........))))))))))))))))))),{|||..{((..(((((((({{((((((..{(.{.(((((((...(((({....(((((.(((((.,{((((......)))),...))))).)).)))....})))))))))))},))..)))).))))))))))).))).,|,||}}}}))).{(((.....)))}...).)).))))))........))))))))..}}||}.....,(((((((((((((((((..((,({,{{(((({..{((......,,,...}}.,}})).((..((((({(((.............))))}(((.(((((...(((......)))...))))).))}.}))))..))..,,,,,...(({,,..,}.....,,}}}}},)),)}..)))))))))))))))))|(((.((....(((((.....)))))...)).))))}}}}}.}}}}}))||{|{{.{..,,}},))))})))}},.,,...,{{.....}}}..{(((((({...)))))))),.)))))..})}}.

Transcripts

ID Sequence Length GC content
NM_002423.5 NCBI
ACCAAAUCAACCAUAGGUCCAAGAACAAUUGUCUCUGGACGGCAGCUAU… 1119 nt 0.4334
Summary

This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal hemopexin domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes on chromosome 11. This gene exhibits elevated expression levels in multiple human cancers. [provided by RefSeq, Jan 2016]

Forensic Context

A study in humans demonstrated that the mRNA marker MMP7 (matrix metalloproteinase 7) is detected in menstrual blood [Bauer et al. DOI:10.1016/j.forsciint.2007.03.016]. Another human study evaluating mRNA markers for body fluid identification found that the MMP7 was present in its target fluid but exhibited high cross-reactivity in semen and vaginal secretions, as well as low-level cross-reactivity in saliva [Richard et al. DOI:10.1016/j.fsigen.2011.09.007]. A study in humans demonstrated that the MMP7 mRNA is a highly sensitive and specific marker for identifying menstrual blood in forensic samples, as part of a multiplex assay with other MMPs [Haas et al. DOI:10.1016/j.fsigen.2013.09.009]. The MMP7 is strongly expressed during the menstrual cycle and re-epithelialization, and its detection via methods like NASBA and RT-PCR offers a precise tool for differentiating menstrual from traumatic blood, though it can yield cross-reactivity with vaginal secretions [Counsil & McKillip DOI:10.2478/s11756-010-0001-2].