Basic Information

Symbol
MMP9
RNA class
mRNA
Alias
Matrix Metallopeptidase 9 CLG4B Matrix Metalloproteinase 9 (Gelatinase B, 92kDa Gelatinase, 92kDa Type IV Collagenase) Matrix Metalloproteinase-9 EC 3.4.24.35 MMP-9 GELB Matrix Metallopeptidase 9 (Gelatinase B, 92kDa Gelatinase, 92kDa Type IV Collagenase) 92 KDa Type IV Collagenase Macrophage Gelatinase Type V Collagenase 92 KDa Gelatinase Gelatinase B EC 3.4.24 MANDP2
Location (GRCh38)
20:46008908-46016561
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis Tissue/body fluid identification Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_004994.3
Sequence length
2336.0 nt
GC content
0.6237

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-980.40 kcal/mol
Thermodynamic ensemble
Free energy: -1020.57 kcal/mol
Frequency: 0.0000
Diversity: 777.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((((((((..((((((((((((.((((((((..((((((((.((((....((((.((......)).))))))))..)))))))).))..((((.((((.((((..((((...(((((.....))))).......((.((((.(((((((((((((((((((....(((.....(((.(((((......((((((((((.......))))(.(((....))).)((((((....)))))).((((((((..(((....)))..))..))))))..)))))).....))))).))))))...)))))))))((((..(..((((((((((((((((((.((((((....))))))((((((..............((....)).(((..........))).....))))))(((..(.((.(.((((((((((((((((((....))).(((((..(((((((((.(........).)))).))))).)))))..(((((...(((.((((((((..((((.((...)).))))...((((.((((.(((((....((((.((((.(((.....(((....)))..)))))))...))))......)))))...)))).))))...)))))))))))...))))).))))))))))))))).).)))..))))))))))))..(((((.((.(((((((......................))))))).))...)))))..((((((..(.((.((((((((.((((((.(.(((((((((......((((((.......((((.....)))))))))).(((...)))((((..(((((..((((((((.((......(((..((((((.......))))))..))).......((((............))))(((((((((..(((((......))))).))).))))))(((......(((..(((..((((.((..(((((.(((((....).))))...)))))...))..))))..)))..))).....)))((((((((.....).)))))))....)).))))))))..))))).))))..))))))))).).))))))))))).))).)).)..))))))(((.((((.((..................)).))))))).)))))))))..)..))))......)))))))).)).)))))).((((((((((.....))))))))))((((((......(((((((((.((.((((((.((.(((((...........(((((....)))))))))).))...)))))).)).).))))))))....))))))...((((((.(((((.((((((..((((.....((((((((((...(((((((((((((((...((((((......)))))).............(((((((((((((......(((......))).((((.((((((((((.(((((((((....((((((..(((...((...(((.((....)))))...))))))))))).....)))))..........(((((((.((....)))))))))))))..)))))))..........)))..))))......))))...)))))))))..))))))))))...((.(((((.(((.............))).)))))))(((((.((.(((((((....))))..))).)).))))).....((((((.....))))))...)))))....))))))).(((.(.(((((((.((((.((...)))))).)))))))))))...))).....))))....)))))).)))))...)))))).)))))))).)))).)))).....((((.....))))))).))))))...)))))))))..))).))).))))).))))..(((((((((((((((.(((((((.((((.......))))(((((...((((.(((.....)))..)))))))))(..(((((.....)))))..)....)))))))..))))))).((.((((((.(.((.......))).)).)))))).((((((.....).))))).((((...(((.((((..((((.(.(((((....)))))))))))))).))).))))...((((((..(((.....)))))))))(((((((((((((.......))))))))).))))..))))).)))(((((..(((.(((((.((((...))))))))).))).))))).......(((((((....(((((.....)))))..))))))).....
Thermodynamic Ensemble Prediction
.,.({.(((((((..,(((.((((((((((.((((.(((({((((((((((.((((....((((.((......)).))))))))..))))))))..{{{....||}((((.....))))...(((((.....)))))..}}))))..)))).))))))......((((((,...,))}}))})))))))))))))).|||{(({(({(((,({,{{((((((((((((((((,(((({{..,,|}}|||.(({((((({{({{...,|||,,||{,||}|||(((...(({,,.,|}{{,|||..,,,{,|||}}}||||||}}})},{{(((((((,{(((((((.((((((....))))))((((.....)))).......{{...,||.,{{........,{||,....,,{|||,,||||||{,.,.((((((((((((((((((..,,|||.{{|||}}||||(((((.{....,,,,}.}}}}.}}})),}}}}),.(((((,{,{((.((((((((..{,,,{((((({,({,{|.,(({{{.(({..,}}}|}},.{((({((({,((((,...|}}.,.,)))),))))))}}}}||}}}},,.,,|||.,,.}))}....,,..))))))))))).}}))))).)))))))))))))))|},||||,,,.}}})))))}..(((((.((.(((((((.,..................|.))))))).))...))))),{((((((.,(.(({((({{{||.|||{{{.,.{||||||||.....,{{{{,,...,,..{{{{.....})))))))},,}})}},,}}{(((,.(((((..((((((((,((....{.(((..((((((.......))))))..))).|.,,,.((((............))))(((((((((.,{((((....,,)})}}.))).)))))){({......(((..(((..{(((,((..(((((.(((((....)|||))...))))),..}}..))))..))),,))).....))){|||||||,..,,|,|})}))|.,,,|,.})))))))..))))).))),..))))))))),|,|||||}}}}}},|||,||,|,,||||||(((.((((.{{,..,,{{,....,,....)}.))}||||..,,))))||{.|,{(|,.,,..,}))})))}})))).)))))}||,|||||||...},)))))))))}((((((......((((((((||(|.((((((.{({((((({..........{{(((,...)))))))))}.))...)))))).}}|).))))))))....})))))...||((((.(((((.(((((((({(((,..{,((,(((((((,,.(((((((((((((((,,,((((((......)))))).......}}}...(((((((((((((..,,,{((({.{,,.||}|{{((,{(((((((((.(((((((({....{{{{{(.,(((,..{,...||||{{....)))))...))),}))))))..,..)))))..........(((((((.((....)))))))))))))..)))))))..........}})..))),,,,...))))...)))))))))..))))))))))...(.{(((((.((((((({..{((({..,,{|||,,(|(,,,,..|}},,))}|...})))},..))))))).)))}}}..{(((((.....))))))...))))),,..))))))),{|{.,.(((((((.((((.((...)))))).))))))),,},.,,))),..}})),))),.,))))).)))))...)))))),},}}))}}})),)))))}})),)))|,|||,,,,)}))))))))}}}||}||||}|||,|{{((((((((...(((.(((.,.((((..((((.....))))..))))..,.))))))..)))))))}...}))),,}},,.||||||||.||,||,{{{{({{{{,|||||(((.({.,|{{{{{,.||||}|{....)),,))))}),})))})..}},))))),...}|||)|}},{{{|....,,.{{{{...(((.((((..((((.{,(((((....))))))))),)))).))).))))...((((({..(((.....)))))))))|||,(((((((((.......))))))))).})))))}))))}}}|(((((,,(((.(((((.((((...))))))))).))).))))).}}.,,,(((((({...,|||||.....)),))}}))))),}.....

Transcripts

ID Sequence Length GC content
NM_004994.3 NCBI
AGACACCUCUGCCCUCACCAUGAGCCUCUGGCAGCCCCUGGUCCUGGUG… 2336 nt 0.6237
Summary

Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades type IV and V collagens. Studies in rhesus monkeys suggest that the enzyme is involved in IL-8-induced mobilization of hematopoietic progenitor cells from bone marrow, and murine studies suggest a role in tumor-associated tissue remodeling. [provided by RefSeq, Jul 2008] CIViC Summary for MMP9 Gene

Forensic Context

A study in mice demonstrated that the MMP9 is a pro-fibrotic gene whose expression is related to Mirt1 levels during chronic intermittent hypoxia-exaggerated post-myocardial infarction cardiac remodeling [Wang et al. DOI:10.3389/fgene.2022.818823]. In a separate investigation using a mouse burn model, the MMP9 was identified as a key gene with significantly increased mRNA and protein expression in burn tissue compared to normal skin, suggesting its role as a potential therapeutic target for severe burn wounds [Guo et al. DOI:10.1155/2022/5220403]. A study in humans demonstrated that the MMP9 served as a control marker due to its expected presence in circulatory blood, menstrual fluid, and vaginal material, being detected in 98.3% of menstrual fluid, 97.5% of vaginal material, and 100% of circulatory blood samples [Albani et al. DOI:10.1016/J.Fsigen.2020.102359]. In a separate human study, the MMP9 was identified as a shared hub gene involved in extracellular matrix remodeling and showed robust predictive performance in artificial neural network models for type 2 diabetes and atherosclerosis [Wu et al. DOI:10.3390/ijms27010136].