Basic Information

Symbol
MNDA
RNA class
mRNA
Alias
Myeloid Cell Nuclear Differentiation Antigen PYHIN3 Epididymis Secretory Sperm Binding Protein
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis

MANE select

Transcript ID
NM_002432.3
Sequence length
1716.0 nt
GC content
0.3782

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-389.80 kcal/mol
Thermodynamic ensemble
Free energy: -422.58 kcal/mol
Frequency: 0.0000
Diversity: 400.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((((((((.((((....))))))).))))........((((((((((((.((((((((((((((((((..(((((((((((((....((((((((.(((...(((((.......((((((.((((((.....))))))))).......))).......))))).))).))))))))(((((.......)))))...(((...))).....((((((.(((((((.(((........((((((((((...))))))))))...(.((((((((((((......)).))))(((.((((.(((((((((..((...(((......)))......................................((((((.(((((......))))).(((((((.((((.(((.....)))))))...((((...((...((((((((((.......((((.((((...((((.......))))......)))).))))..........(((..((......))..)))..............((....((((((((((((((............))))))))......((..(.((........)).)..))((((((...((((((............................))).)))....))))))..(((((((((...(((((....((.....(.(((....))).)..))...)))))...)).))).)))).))))))...)).........................((((((((((..(((......))).......(((....))).((.(((.(((........)))))))).))))))...))))..))))))))))))....))))))))))).........))))))((((.....))))...((((..........)))).))..))))))))))))).)))...)))))).)....(((((.(((....(((....))).....)))...)))))...)))))))))).))))))...)))...)))))))).))...))))))...))))))....(((((....((((((((........))))))))....)))))..........)))))).....((((((.......(((...........((.(((((.........))))).)).(((.(((.((((((...........))).))).))).)))...............((((((........)))).)))))......))))))))))))))))))............(((...((((.....))))..)))...(((..(((((((....)))))))..))).((((((((......((((((((..(((((((((...((((.....))))...................((((........))))....))).))))))..............))))))))....((((((...))))))....((((.(((((...))))).))))...((((....)))).)))))))).....((((((((........(((((((((((((...))))))))..))))).....)))))))).......)))))))))))..((((((.....(((((((...(((((((((..(((...))).))))))))).....)))))))......))))))
Thermodynamic Ensemble Prediction
((((((((((((((((((.((((....))))))),))))........((((((((((((({(((({((((((((((({,,(((((((((((({....((((((((.(((...(((((.......((((((.((((((.....))))))))).......})).......))))).))).))))))))(((((.......)))))...(((...))).....((((((.(((((({{(((........,{{(((((((,,.}}||}}}})|,,.,.{{{((((((,..,,,,,.,,.}},,{{|.(((||(((((((((..((...{{(......}}}.......|,,.,.|,,,,.........,,....,,.,.{{||||.(((((......))))).(((((((.((((.(((.....))}})))...{(((...{{...((((((((((.......((((.({{(...((((.......))))......)))).}})}..........(((..({......}}..)))...........,..{{,.,.,.((((((((((((,.,,{{,.....}}||}}}}......(({{..{{{{{,{{,,{,{(({{{((((((...((((((............................))),,))....))))))..(({{{{{|,.,.((((({{..((.....({{{{,,..))}}),.))...)))))..,}|,||,.}},}..}}}}.......,,..,..........,,}.,,,..{,|||{|||,..|||,,.,,,)},.......(((....))).||,|{{,|||.,......}}))))}}.,}}}}},,.}})}..))))))))))}}....))),))))))).........,,}))}((((.....))))...{(({...,,,,},.)))}.))..))))))))))))).},}..,}}}})),||...(((({.,{,.,,.{({....}}}...,}))},..)}})}...)))))))))).)))))),..}})...)))))))).))..,))))))...))))))....(((((....((((((((........))))))))....)))))..........}}}}},.....((((((.....,.,{{..,,.......,,.(((((,........}||||.|,..(({(.({((((.,........}})))).)))}.....}},}..,,.........,,((((........)))).}))})},..,.))))))))))))))))))....,.....,,{(({,,({{(,....,,))..))}}}}|((..(((((((....)))))))..))}.((((((((...,..((((((((,,((((((({({,.((((.,...}}||...........,,..,,.}|.,|,..,|...,}}},...|}}|}}||}}...||.........})))))}}....{(((({...))))))....((((.(((({...})))).))))..,|{{{....}))).)))))))).,,,.((((((((.,......(((({((((((((...))))))))..))))).....)))))))).......)))))))))))..((((((.....(((((((...(((((((((..(((...))).)))))))))..,..)))))))......))))))

Transcripts

ID Sequence Length GC content
AGUGUAAGAAGGCCAUCUACAAUCAAGAUUGAGAGUGGCUCUAACAAGU… 1716 nt 0.3782
Summary

The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the MNDA as a blood-specific mRNA marker selected from microarray analysis and successfully validated by RT-PCR for forensic body fluid identification [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. Another human study, analyzing time-wise degraded stains, confirmed the MNDA as a stable mRNA marker for blood, with expression detectable in stains aged up to 180 days and showing no detectable amplification in semen samples [Zubakov et al. DOI:10.1007/s00414-007-0182-6]. A study in humans demonstrated that the MNDA mRNA was down-regulated by 28% in pericontusional brain tissue from a patient with traumatic brain injury (patient T3) compared to control tissue, as identified through cDNA microarray analysis [Michael et al. DOI:10.1016/j.jocn.2004.11.003]. This differential expression was part of a broader pattern where 104 genes showed significant changes, with the MNDA categorized among development, differentiation, and trophic factors.