| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUAAGAAGGCCAUCUACAAUCAAGAUUGAGAGUGGCUCUAACAAGU… | 1716 nt | 0.3782 |
The myeloid cell nuclear differentiation antigen (MNDA) is detected only in nuclei of cells of the granulocyte-monocyte lineage. A 200-amino acid region of human MNDA is strikingly similar to a region in the proteins encoded by a family of interferon-inducible mouse genes, designated Ifi-201, Ifi-202, and Ifi-203, that are not regulated in a cell- or tissue-specific fashion. The 1.8-kb MNDA mRNA, which contains an interferon-stimulated response element in the 5-prime untranslated region, was significantly upregulated in human monocytes exposed to interferon alpha. MNDA is located within 2,200 kb of FCER1A, APCS, CRP, and SPTA1. In its pattern of expression and/or regulation, MNDA resembles IFI16, suggesting that these genes participate in blood cell-specific responses to interferons. [provided by RefSeq, Jul 2008]
A study in humans identified the MNDA as a blood-specific mRNA marker selected from microarray analysis and successfully validated by RT-PCR for forensic body fluid identification [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. Another human study, analyzing time-wise degraded stains, confirmed the MNDA as a stable mRNA marker for blood, with expression detectable in stains aged up to 180 days and showing no detectable amplification in semen samples [Zubakov et al. DOI:10.1007/s00414-007-0182-6]. A study in humans demonstrated that the MNDA mRNA was down-regulated by 28% in pericontusional brain tissue from a patient with traumatic brain injury (patient T3) compared to control tissue, as identified through cDNA microarray analysis [Michael et al. DOI:10.1016/j.jocn.2004.11.003]. This differential expression was part of a broader pattern where 104 genes showed significant changes, with the MNDA categorized among development, differentiation, and trophic factors.