| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUACAGUUCCGGUGGGAGAACGCGGCUGCGAGGUUUUCGGCUUUGGCU… | 7627 nt | 0.4112 |
The protein encoded by this gene localizes to the centrosome during mitosis and to the midbody during cytokinesis. The protein is phosphorylated by cyclin-dependent kinase 1 during mitosis and subsequently interacts with polo-like kinase 1. The protein is thought to function in regulating mitosis and cytokinesis. Mutations in this gene result in nonphotosensitive trichothiodystrophy. [provided by RefSeq, Nov 2009]
A study in humans identified the MPLKIP as a single-gene blood biomarker, where a machine-learning classifier using 25 genes, which included this marker, differentiated healthy controls from methamphetamine-dependent subjects with 87% accuracy, and a classifier using 20 genes further differentiated methamphetamine dependents from those with methamphetamine-associated psychosis with 95% accuracy [Breen et al. DOI:10.1038/tp.2016.67].