| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCCUGGUCCCCCACUUUCUCAACCCCACAGAUGCUCCGGGCCCCUG… | 1951 nt | 0.5597 | |
| AGUUCCUGGUCCCCCACUUUCUCAACCCCACAGAUGCUCCGGGCCCCUG… | 1951 nt | 0.5597 |
This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in this gene are associated with autosomal dominant form of Charcot-Marie-Tooth disease type 1 (CMT1B) and other polyneuropathies, such as Dejerine-Sottas syndrome (DSS) and congenital hypomyelinating neuropathy (CHN). A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2015]
A study in mice identified the MPZ as a marker for glia cells, specifically Schwann cells, within the cellular heterogeneity of interscapular brown adipose tissue [Behrens et al. DOI:10.1016/j.molmet.2025.102252]. A study in Calliphora vicina demonstrated that the MPZ exhibited constant expression levels with no significant differences over time or between diapause and non-diapause conditions, though a cyclic pattern could not be excluded [Fremdt et al. DOI:10.1007/s00414-013-0920-x]. In Sarcophaga peregrina, the MPZ was evaluated as a candidate reference gene for RT-qPCR normalization, where it was ranked as highly stable at 35°C and 25°C for intrapuparial age estimation [Shang et al. DOI:10.1093/jme/tjz137].