Basic Information

Symbol
MRC1
RNA class
mRNA
Alias
Mannose Receptor C-Type 1 CLEC13DL CLEC13D BA541I19.1 MRC1L1 CD206 Macrophage Mannose Receptor 1-Like Protein 1 C-Type Lectin Domain Family 13 Member D Mannose Receptor, C Type 1-Like 1 Macrophage Mannose Receptor 1 Human Mannose Receptor MMR HMR C-Type Lectin Domain Family 13 Member D-Like Macrophage Mannose Receptor Mannose Receptor, C Type 1 CD206 Antigen
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_002438.4
Sequence length
5188.0 nt
GC content
0.4260

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1473.20 kcal/mol
Thermodynamic ensemble
Free energy: -1572.79 kcal/mol
Frequency: 0.0000
Diversity: 1070.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((.((.((((..(((...(((((((((((.(((.((((((((((((.((((...(((((..((((...((((((.....))))))..))))))))).......)))).)))))))).)))).))))))...))))))))...))))))).)).)))))).(((....)))...(((((((((((((........))))))).......((((((((((((((.((.....)).)).))))))...)))))).((((((..(((((((..(((...........))).)))))))....((((.....)))).)))))).........))))))((((((.....((((((((.(((((((((...(((((.((((..(((.((.(((.....))).)).)))..)))))))))......(((((((.(((((((...((((((((((((................((..(((((((((((((.(((.....((((((.(((........))).))))))((((((..(((((.((((..((((((...)))))).)))).))))).........((((((((((....(((((.(((.....((((.(.((((((.((.((((((..((((....))))))).)))..)).)))))).)))))((((.(((.....))).)))).(((((((..(((((((((((((.((((..((.((((.(((((((..(((((....(((((..(..(((((((....(((........)))...))))).))..))))))......)))))..)))))))..))))....(((((.((((.(.((((...(((((((((.......(((((.((((.((((..((...))..)))).)))).......((((((((((.........))).))...))))).(((.((((((.......)))))))))......))))))))))))))..((((((((((((..((((((....((.(.(((((.....((....))))))).).))..))))))..)))))).))))))...)))).).....................((((((.....))))))..)))))))))...........(((((.((.((((((.......................)))))).)))))))..))..)))).)))))))))))))))))..)))((((((((((......(((.((....)).))).......(((((.....)))))....(((......)))..))))))))))((((.....((((((...(((.....((((.(((...(((((........))))).)))))))....)))..))))))((.(((((((..(((((........)))))..))))))).)))))).((.((((((((...((((.....(((((((.((.....)).)))))))..)))).)))).(((((((((((.((((((((....(((.....(((((..((((.((.(((((((((((.((((..((((((((.(((((...))))).........))))))))(((((......((..((((......)))).)).......))))).........((((((.(((((...((.(((.(((((...(((((....((((((.............))))))...))))).(((((.((((.((....((.((((((..((((....(((((.((((.(.(((((((....((((.((((((((...(((.((((((.......)))))).)))....((....))...(((((((((...((((((.......))))))....))))))))))))))(((((((..(((....)))..))))))).))).))))...)))))))))))))))))))))...)))))).))...)).)))).))))).....))))).))).))...))))).))))))...)))).)))...))))).)))...)))))).)))))...((((.((...)).))))..((((.(((..(((.(((((.....)))))))).)))..(((.....((((((.((.((((...))))....(((((.(....).)))))..((((((....)))))).((((((((((((...(((((.(((((...((((....(((((((.(((((...((((......))))...))))))))))))..))))...........((((((((..((((((((((.((((...(((((.((((........((((((((((((((((((((.((...............((((((((((((((((((((((.((((((..((....(((((.......))))).....).)..)))))).....((((.....))))........(((.............)))..........))))))....(((.((((((((.(((......))).)))))))).)))......)))).))))))....)))))).(((((.(((..(((((((((((((....)))).((.((.(((((..((((((..(((.(((((((((((((((((.(((((..........(((..((((((((((.((..............)).))))))))))..)))((((((.((((((...............)))..))).)))))).(((((((((.((((.(((........))).)))).))..)))))))...............(((((((((((((.((((((.....(((((((((((((.......((((((...((((...((((((.(((((.((.(.((((((.((((((....))))))....))))))))).....(((((.(((...)))))))))))))))))))))))....)))))).......))))))))))))))))))).)))))................(((((.....)).)))(((((((....)))))))(.((((((((((((((.(((.....)))...(((((.......))))).(((.((....)))))......(((((((((((.....((..((((((.......))))))..))..(((((....)))))(((((((.....))))))).......((((((((..(((((....((((((.......((((((..((((...))))....)))))).((((((((.(((.(((((((((........((......))....)))).))))).))).))).)))))(((.......)))........))).)))......)))))..))))))))(((.((((((((((.(((..(((((((....))))))).((((((((.((....(((((......))))).((((.(((((((.((.....)).)..)))))).............))))((((((((........))).)))))...)).))))))))(((((....))))).........(((((..(((((((...((((......))))..........((((((......)))))).)))))))..)))))....((((((.......))))))............))).))))....)))))))))..))).))))))))........(((((..((((((....))))))..))))).)))))))))....))))).)..((((..((...((.((((...)))).))...))..)))).))))))))((((((......)))))).))))).)))))...))))))...........)))))).))))))))).))))))).)))))))....))))..)))))))))))))))))...))))..........)))))))))........))))..)))))))))..)))))))))).(((((((((((....))))))))))).)))))))).....)))))((((........))))((((((((.(((........))).)))))))))))))(((((((((..(((..((((.((((((.((.((.....)).))..)))))).)))))))))))))))).((((((.......))))))............))))))))))))...)).)))))).....))).........)))).(((..(((((((((...........)))))))))...))))))......))))))))..)))))))))))........)))).))))).))))).....((((((....)))))))).)))))))).)))))).....((((....((((.......((((......))))))))....))))(((.(((((((((.(((..(.((...((..((....))..))....)).)..))))))).))))).)))..(((.(((((.((....)).))))).)))...((((.((((((((........))))))))))))...))).))))))).......(((((......))))).))))))))))))))))))))......((((((.((..(((((.(((....)))..))))).)).))))))...((((((..(((((....)).)))...))))))......(((((((.((((.((((((..(((((((((.((((...........))))))).)))).))...))....)))).)))).......))))))).......((((((((((......))))))))))))))))))))))))...........))))))))).(((.((((((((((((((.......((.........)))))))))((((....)))).....))))))))))...)).)))))).....))))))............(((((((((((....))))....)))))))))))))(((.((((((((...........((((((((..(((((((.(.((..((((((((((((((((.(((....))).)))))...))))))......................)))))..)).)..)))))))....)))))))).........)))))))))))............
Thermodynamic Ensemble Prediction
..,{{(((((((.((.((({..(((...(((((((((((.(((.((((((((((((.((((.{.(((({..((((...((((((.....))))))..))))})))}...,.,.)))).)))))))).)))).)))))}..,))))))))...))))))).)).))))))){((....)}}..(((((((.,,(((({,{,....,}}}}}}.......((((((((((((((.((.....)).))},)))))...)))))).((((((..(((((((..{((...........))).)))))))....((((.....)))).))))))..,}}}...)))))))((((({{(((....{{.,.(((((((((...(((((.((((..(((.((.(((.....))).)).)))..)))))))))......(((((((.(((((((({{(...(((({,,{..{{{({{{{..,,..{,...,,|.,.||,}}}}}}}}...,.})}}......)}}}..(({,.(((((,..((..((((((({({((,.,{((((...))))|((((((..(((.,,...(((..(((.....)))..))).,,)))..)))))),..{(((((({{,..|,{((.(({.(((((((((,(((((..((((.((.((((((.,((((.(((.....))).)))|{(((((((..(((((((((((((.{{{{..{,,{({{..,,({{{,.{{||||,..,...,.||,{((((((({..,{{,..,{{{{,.||.{{{|{||,,|,|||{||,...{{(({{....|{{|...{{({,.....}|||,.{({({,.,{,....(((((((((.......(((((.((((.((((..((...},}.)))).)))).......((((({((((.......,.}))}}}...))))).(((.((((((.......)))))))))......))))))))))))))..((((((((((((..((((({....{{,,.{{(({..,,,({..,,,|}}}}},}.},..})))))..)))))).))))))...})))))......,,,,...}))),..})))))|||||||||||...})))))},))))}.,.....((((,,((.((((({......,.,,,.........,}})))))).)))))))..))}})))),))))))))))))))))),.}))||,.{((((({..,{{{..{(({{{.||..........,(((((.....)))))....(((......))).{(({((({|{{((((....,((((((...(((.....((((.(((...(((((........))))).))))))).,..)))..))))))|(.(((((((..(((((........)))))..))))))).)})))).||.{{{{((((...((((.....(((((((.((.....)).)))))))..)))).)))).(((((((((({.((((((((....(((.....(((((.,{(((.((.(((((((((((.((((..{(((((((.(((((...))))).........)))))))}(((((......||,,((((......)))).||,......)))}}.........((((((.(((((...((.{((.(((((.{{((((({(((((.((({{{((..(({...|{{{...{(((((....))))}|,..|,....,{..,,|||,.,.,....((((({{((((.{,(((((((....((((.((({({{{...{({.((((((.......)))))).})}....((....)}...(((((((((...((((((.......))))))....))))))))),))}|(((((((..(((....)))..))))))),))).))))...)))))))))))))))))).)))..))))))}))}})),.)))).})))......))))).))}.))...))))).))))))...)))).)))...))))).)))...)))))).)))))..,((((.({...}).))))}.((((.(((..((,{(((((.....)))))))).)))..(((..,..((((((.((.,,,,...||}}....(((((.(....).)))))..((((((....)))))).((((((((((((...(((((.(((((...({((,,,.(((((((.(((((.,.((((......))))...)))))}))))))..)))).,,,,}....,((((((({..((((((((((.{((,..{(((((.((((....,,,.((((((((((((((((((({(((...............((((((((((((((((((((((.((((((..{,....(((((.......))))).....},}..)))))).....((((.....))))........,{{.......,,.....,,,.,,......))))))....|{{.((((((((.(((......))).)))))))).}}}......))))}}))))}...,)))))).(((({,(((,.(((((((((((((....)))),{{.{,((((((..((((((..(((.(((((((((((((((((.(((((......,,{{{{{,.|||||||{{{,|{.{{{{,.,{{{{...,.)))))))))).,{.{((((((.{,{((({{.,.....,}}}}}}},}.}))})))})).(((((((((.((((.(((........))).)))).,)}.}))))))...............((((((((.{.((.,(((......(((((((((((..,.(((.....)))....)))))).}))),((((((((((((.((((((.((((((....})))))....))))))............(((((((..((((((((((((((((((((((.,,{{{.,.........|,{(((((((((....))))).))))}.,............,(((({..((((((..(((((((....})))))}((((({{{{{{{.|||,||,.....,,}....}}},),}).})))))}.}}.......((((((......))))))))))))....((..((((((.......))))))..))..(((((....)))))(((((((.....)))))))......(((((((.........)))))))......,,.((({,((((({....)))))))))..}}((.((((((((.(((.(((((((((........{,......}}....)))).))))).))).)))}}}))).))......})))),......)))))}}})))))))........{(({,{,(((.((((...((((((((((((((....)))))))})).(((((.......(((((......)))))))))).(((((({.((.....)).}..))))))...{(((.,,.((((((((((((((........))).))))).......)))))).,}|.)))}.)))))..))))))),}.)))).)))))))).((((......))))...............)))))))...((((.((((..((({.......((((((.,.....))))))..........{(((.{..((((((({{(((((,{{({{,.{{{.....}))}.)}|{(((..((((((....))))))..)))},)))))))))))))..,..)))))))..))))))))...,)}})))))))))...}))}}))}.))))))))((((((......)))))).))))).)))))...))))))...........)))))).))})))))).))))))).},}))))....)))).,)))))))))))))))))...}}}}.........,))))))))).,,.....))))..)))))))))..)))))))))).(((((((((((....))))))))))).}))))))).,,.,)))))((((........))))((((((((.((({.....}.))).))))))))))))){{{((((((..{((.,((((.{{{{||,|,,{,||.,,,)|||,,}})))}.}}}}})}))))))}}),((((({.......)))))}......,.....})))))))))))...)).))))))..,..))).........)))).(((..(((((((((...........)))))))))...))))))......))))))))..}))))))))))........)))).)}}}}.}}))))))).{(((((....}))))),,,.{.((((.(((........)))))))},,,.....}}}}||||,}}}}}))))|((((...(((((.((...................)).)))))...))))}.,,,......)))))))).)))).))))).,.{{(.(((((,((,,..,,.}}))),))}...{(((.((((((((........)))))))))))).,{{||{|||||{{{{,....(((((......))))){|},,,.}}.,,,,,,,,,,,.,...}}}}}}}}}}}}}}}}|}|}}}}}.})).}))}{{((((((({.....((((((..{{,,{....}}.}},...)))))))))))))))}.,...}}})}}))}...,,(((((((.((((...........))))))).)))).}),..},}}}.})))))))))..)).))))).)))).....((((((((({......})))))))))))))))))))))))...........))))))))),..}}....,.((((((((.......{,.......,,,,))))))))|,,....,}}....(((((..,...(((({{((((((((((({{({(((...{{{{{.({.,..,,,,((((((({{{({{{{{{{{{..{(((({,{(,,{(((({......,,,},,,,,,,,}}}}))),.}}}}))),,,,,})))))}..,,|||.|||}}}}))),),}))}}}...))),)}))))))))))))))))...,.,.))))))))))))))...((((((.......)))))).,|,|..,}}||{{,...,,}}).

Transcripts

ID Sequence Length GC content
CAGCUGGGCAGCUCUGGGAACUUGGAUUAGGUGGAGAGGCAGUUGGGGG… 5188 nt 0.4260
Summary

The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]

Forensic Context

A study in mice demonstrated that the MRC1 gene, associated with reparative phenotypes, was increased in female microglia compared to males after spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8]. In human skin wound healing research, the MRC1 was identified as a marker for pro-resolution macrophages within the comprehensive cellular atlas [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in mice demonstrated that the MRC1 (Mrc1) is a top cluster-defining gene for an 'Anti-Inflammatory' macrophage subpopulation in the meninges following traumatic brain injury [Bolte et al. DOI:10.7554/eLife.81154].