Basic Information

Symbol
MRC2
RNA class
mRNA
Alias
Mannose Receptor C-Type 2 ENDO180 CLEC13E C-Type Lectin Domain Family 13 Member E Endocytic Receptor 180 KIAA0709 CD280 Urokinase-Type Plasminogen Activator Receptor-Associated Protein Macrophage Mannose Receptor 2 C-Type Mannose Receptor 2 UPAR-Associated Protein UPARAP Endocytic Receptor (Macrophage Mannose Receptor Family) Urokinase Receptor-Associated Protein Mannose Receptor, C Type 2 CD280 Antigen
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006039.5
Sequence length
5719.0 nt
GC content
0.6333

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2601.10 kcal/mol
Thermodynamic ensemble
Free energy: -2689.97 kcal/mol
Frequency: 0.0000
Diversity: 1549.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((...((((((((((((((.((((((((((((((..((((((.((....)).)))).))...))))))((.(((((((...))).))))))((.((((((..........)))))).)).((((.(((((((((((((.((((((.......))).)))..))))))))).))))..)))))))))))).))))..))))((.((((((..((((((..((((((((...))).)))))((((.((((...(((..(((((((((.......(((.((((((.(((((((((.(((..((((((((((((((((...(((((.....)))))..............))))))).))(((((...((((...))))...))))).......))))))).))).)))).(((((....)))))..(((((((...........(((((((..((((((((((((..(((.((((((((........)))).)))))))..)))))))((((....)))).......)))))..))))))).((....))...........))))))).))))...(((.(((......))))))....((((((.((((.(((.((((...(((((((.((.(((((.(((((.(..(((.(((((((..(((((((.((((...))))......(((((((.(((((.....(((....)))......)))))..)))))))((.((.....)))).....)))))))..((((.((((......)))))))).((.((.......))))(((((((((....)))))).....(((....))))))))))))).))).....(.(((.((((.((..((((((...((((.....(((((..((((((....)))))).))))).))))..))))))..))))))..))).)((((((.((((...))).).))))))..).)))))..)))))....))))))))).(((....)))(((((((((((((...(((((......((((.(((((((((((.((((.((((.(.(((...((((.(((....(((......)))))).))))..(((((((.....(((....(((((....((((((....)))))).....))))))))))))))).....)))).)))))))).)).))))......))))).))))...))))).....))))))....(((((((..........))))))).........)))))))(((.(((...))).)))(((((...)))))..((((........))))))))))).)))).)))))).).))))))....)))..((((...))))((((((..((((((((((.......(.((((((((.((((((((((((.....((((.((((((..(((((.((...........)).)))))...).)))))..)))).))))))))((.((((((((..((((.(((..(((.........))).))).((((..........(((.((((((((....))))))))..)))..........))))))))..)))))))).))...((((...))))..)))))))..))))).).(((((......)))))...))))).)))))..)))))))))))))))..)))...)))).))))..(((.(.(((...)))).))).....((((((((((..((((((((((.(((........(((.(((((((..((.(((.(((((((((((((.((.((.(((..((.((((.((((..((.(((....))).))....((((((.((.(((((((((((.........((((((((((((..(..(((..((((.(..((.(((((((.((((((((((((((.((.(((((((((((......((.((((((((((.((((((.(((((.(((((((..((((((((((.((...))))))))))))((((.((((((..((..((((........))))...(((.((.......)).)))...((((.((((((((.((...)).)))).)))).))))))..))))))))))((((.....))))...))))))).))))).))).)))..(((.......)))...((((((((((((((..(((..((((((..((((...((...((((((((((((((((...)))))).((((...)))))))))))))).))...))))))).)))..)))...)))))))))))))).....(((((.....((((((.(((........))).))))))...)))))...)))))))))).))((((....(((((((...((..(((((((((.((((((((((((......))))))..(((......))).)))))).))))((..((.(((((.((((.......(((..(((((((..((((((.(..(((((.(((......))).)))))).))))))....))))))))))..((((((...))))))......)).))..))))).))..)).........)))))..)))))))))....))))(((((((....((((((((.....((((...)))).((((.....))))((((.......)))).((((((.(((((((.(((...((((..(((.(((.....))))))...))))......))))))))))....)))))).(((..((.(((((((((((.((...(((((((.(.(.(((..((..(((((.((((.....)))))))))))..))).).).)))))))....))....))))))))).)).))..)))))))))))(((......)))..))))))))))))))))))..((((((....)).))))((((.(((((((.((.......(((.(((((..(((((.((((((..............(((...(((((((((((..(((.......)))..)).)))))))))...)))(((((....))))).........)))))).)))))..))))).)))..((((((.(((.(((...((((((((((((..((((((.((((((...(((.((((((...(((((((...(((((.......(((.((..((..........))..))))).....)))))....)))))...))...))))))..))).)))))).))))))((((.....))))......))))))))).)))....))).)))..)))))).))))))))))))).((((((....))).)))........((...(((((((((.....)))))))))...)).(((((((...((((((((((((..((.(((.(((.((.(((((.(..((.((.((((........))))..)).))..)))))).)))))))))))))))).((((.((((((.((((((..(((((((.........))))...........(((((........)))))(((((..((.(((..(((((((.((((((((.(..((.(....((.(((.((((((((((.................((((((((((.(.(((.(.((((((((((.((....)).)))))....))))).).)))).)))))))))).(((((((..(((((.........))))))))))))..))))))))))))).))..).))..))))).)))).)))))))))).))..)))))..)))..)))))).(((....))).(((((.........)))))..)))))).))))....)))))).)))))))....)).)))))........((((........))))((((....)))).(((((.(((((.((((((((((....))))).............))))).))))))))))))))))))).))))))).))....).))))...)))..)..))))))))))))))))).)))))).)))))))).)))).)))).)).))))).)).))).))))))))).)...))).))..))))))).)))((((..(((...)))..))))....))))))).)))))).((.(((((...((((((((.............(((((((....(((((((((((((((..(((.((((........((((.(((....)))))))......))))..))).((((((((((((((...((..((((...))))..)).))))))).(((((.((((.....(((((((..(.(((((((((((((.(((......((((.....))))))).))))))))))).)).)..)))))))(((((((((((.((.((.(((((((((.(((.(((..((((((((.........(.(((((((((((.((((....(((...((....)))))....))))))..)))))).))).).........)))))))).....)))))).).))))).................))))))).))))))))))))))).)))))))))))).)))))))))).))))).....))))))))).))))))..))))).))((((((.(((((((((((....(((((.(((....(((.((((((....(((((.(((((((((((.(((.((((((.((..(((...(((((((......)))))))..))).)).)))))((((((((....))))))))((...((((((.(..(((((((((((....)))))).)))))..)))))))...))(((((..(((((...))))))))))..).)))))))))))))))))))..)))).)))))(((....))).....(((((((((((((.(.(......).).))))))))...))))).))).)))))..(((((((((.(((....)))....((((((...((((((......((((((.......(((((((..((((((.(((..((((((((((((.((((....)))).))))))....)))))).))).))))))...((((.....(((....)))..)))))))))))....)))))).))))))))))))))))))))).((((((......(((((((.(((((((.((.(((.(((((((((((((....(((((((((((((.((((.((((((((........)))))..))).)))).)))).)))))..))))(((((((...(((((.((...)).))))))))))))((((((........))))))....)))))))))((((.(((((.....))))).))))...(((((.((((....)))).))))).(((((.(..(((.((((((....)))))).))).)))))).......)))).))).)).))))))).)))))))...)))))))))))))))))..))))))...))))))))))..........))))))......))))))...)).))))))...)))).((((..........)))).....((((((..(((....((((((((.(((..(((.((((((((..................))))))))...)))....))).)))))))))))....))))))
Thermodynamic Ensemble Prediction
.((((.,.(((((,,{.(((,((((((((({((((((((((((..(((..(((((((.,.{,,..(((((|(,((((((((...}))}}))))}}}|||,(((((((.(((((.{{(((((...)))))||||||(((({(,((,,{{||||.,.))|,|||..|||||||||.|,,..(((((((((.((((({(.((((((.(((((((.(((({{((((({(....,.,.))))))))((((((((((...,,,..(((((((((.,,,,{{({{,(((({{{({(((((((({(({{(((((((({(((({(({,.(.{{{..,..|||||{,....{{{{{{{.,,|||||{{{((((,..((((,.{{((((....}||,.......,||))),.))}}.)))))}}))))}}.))))))|(({(({.......||..|{{{,||,,||||,(((((((..(((.((((((((........)))).)))))))..)))))))((((....)))}.......,})|}|,}|}||}},((....}}...........}}|}))|,|{|,.,.{|{.||||.,,,}}}}|}}..,,((((({,((((.(((.(({(,,.(((((((.((.(((((.(((((,{..(((.(((((((.,{{{{(((.((({...,}}|,,||..,{|||||.{{{{{,|,..(({....}))......|||||,,|,|||||(...}})).,)))))))..)))))))..((((.((((.....,)))))))).,,.||||.....,,.}|{.((((((....)))))).,...,{{....,})}},))))))).))).....{.(((.((((.((..((((((...((((.....(((((..((((((....))))))|))))}.))))..))))))..))))))..))),}((((((.((({...})).).))))))..,.))))).,}))))....))))))))).(({,,..}}|(((((((((((((...(((((......((((.(((((((((({.((({{((((.(.(((...((((.(((....(((......)))))).))))|.(((((((.....,{{{,,,({(((..,,({{{{{....)))))),}...)})))))))))))))}....)))).)))))))).)).))))......))))).))))...))))).....))))))..{.(((((((..........))))))),...,.,..)))))))|{{.{||...))),})}(((((...}))))..((((........)))))))}})}.)))),)))))).}.,)))),.,,,))}.,||||...)))}{||||{..|||{|{{{{{.....,,{,{{{{{{{.||||({(((((((.....((((.((((({..(((((.((...........)).)))))...}.)))))..)))).)))))))}|{.((((((((..((((.(((..(((.,....,}.))).))).((({...,.,....{{{.((((((({....}))))))),,}))....,,,...))))))))..)))))))),)},..{{{|,.,))))..)))))})}}))}}),},||||{,,,,.,||}||,,.}|||,.})))}.,)))))))))))))))..}||||((.(((.((((((.........)))))).})).}},.,{{((({||{{,||.||..{{{{{,..,,{(((((({,{(,((||,,}}.}||,,,..}||,}}})}))))))),....{{{....)))..,.}},))}}}}},}}.})))))..........))))))))))..((((((((((..((,{{{{{{||.||....,,{,.((((((((.((((((((..(((((((..({........}}..)))))))((.((((((((((.((((({.(((((.(((((((.,((((((((((,((...)}))))))))))((((.(((((({(((..,,,,..}}}}}},,||..{((({((.......)){|||,{.{(({{((((({||.||,.,}),)),}}))))}))))),,.}}))))))))((((.....))))...))))))).))))).})).)))..{((.......)))...((((((((((((((..(((..((((((..((((...{{...((((((((((((((((...)))))).((((...)))))))))))))).))...))))))).)))..)))...)))))))))))))).....(((((.....((((((.(((........))).))))))...)))))...)))))))))).)){{(((((....))))).,}))))))))((((.((((((((((((......))))))..(((......))).)))))).))))))))))))..,,.,,.,,.,,...{{|,.{{{((((.,((((((.{..(((((.(((......))).)))))}.))))))..}.)))}))))},..||{|||,,.})}})))))))))))).)).))))))).)))))).)}..{,,{.,..{(((.,({(((.{({,,,||||||}.},,)))}|||,....{{{|...)})),||}|}},.,)}})))))))))))))))))((((((.(((((({,(((.,.((((,.(((.(((.....)))))),..})))......))))))))))....)))))).(((,,((,(((((((((((.{{...(((((((.(.{.(((..((..((((({{(((.....)))))))))))..))).),).)))))))....,}....))))))))).)).}}..}})(((((((((((((((.(.((.....)).).)))...))))))...)))))).))}),),))))))}.||{(((({,,...{((({({(({{{((((({,((((({{{...,,,.....{((...(((((((((((..(((.......)))..))))))))))))...)))|||{({{..,,,,}}}.......}|}}}}.|||||,.|||||{|||...,,,{(.((({(((((((((({({(((((..((((((.((((((...(((.(((((({{,{,(((((...(((((.......(((.((..((..........))..))))).....)))))....))))).,,))...))))))..))).)))))).)))))){(((.,...}}}},,,|{.|}}}}}}}{{{.{((({,{{{|||,.{|{{{|.{||...,)))))),),}}))},})))})))},,,,....,,...(((((((((.....))))))))).,,)).}.))))))))))))),((((((..((.(((.(((.((.(((((.(.,((.(({(,,,....}}}}},,)}|},.}}..,))))).)))))))))))))))).||,,(((((........))))}}}}.))}}}....,}}....)))}}}},.{((((........)))))|||||}}((.(({..(((((((.((((((((.(..((.(....((.(((.((((((((((.................((((((((((.(.(((.(.((((((((((.((....)).))))}...,))))).).)))).)))))))))).((((((({.(({(({.....}}}))),))))))))..})))))))))))).))..).))..))))},)))).)))))))})).))..,))))}})))),))))))},))})),,,....))))))).)))...)))))))))))),)))}}((((((.....,.))))))}})))))}}}........((({...}))).(((((((((((({.,.(((((.(((((.((((({((((....))))}.............))))).))))))))))|,((((((.(,,((,(((,(.,{.}||||.}},,.,||||,||,},}||{||}|{(((({{,,}}}}}.))))),...,{{{(({,.||{{||}|,|((,((.,,...}||||((((((.((((((.((((,,,((((..(({...}))..)))}..,.}}}}.))}))}}}}||}.(((({...((((((((.............(((((((....(((({((((((((((.{(((,((((.,....{,((((.(((....))))))).,.},,)))).,)))}((((((((((((((...((..((((...))))..)).))))))).(((((.((({..,..{((((((..(.(((((((((((((.(((.,,..,({{{.,,..))}}))).))))))))))).)).)..)))))))(((((((((((.({{((.(((((((({{,{{.(({|.((((((((,...{{...{.((((((((({(.((((,,..(((...{{....))}))....)))))}..)))))).))).,..},...,,))))))))...|.})),}).).})))).............,...))))))).))))))))))))))).)))))))))))).)))))))))).})))).,...)))))))))}})))))..))))).{,{(((((.(((((((((((....((({(,({(,.,{(((.((((((..,.(((((.(((((((((((.(((.{(((((.((..(((..,(((((((......)))))))..))).)).)))))|{{{{(({....)))}||}|({,..((((((.(..(((((((((((....)))))),,))))..)))))))||||((((((..{{{...,))})))))))),,}.))))))))))))))))))).,)))).))))))||},.})}......(((((((((((((.(.(......).).))))))))...))))).}}}.}}}}}..(((((((((,{({....}}},,,.(((((({..{(((({,...,.((((((..,.,..(((((((..{{{{,{.(({,{((({{{(((({,,((({{{{{|||{{|,,,||,{,.}}}))),)}}}))))))},.,,|{,,},.{{|,},.)}),,)))))))))))..,.)))))).))))))))))))))))))))).{(((((......(((((((.(((((((.((.{((.(((((((((((((....(((((((((((((.((((.((((((((........)))))..))).)))).)))).)))))..))))(((((((,..(((({.((...)).})))))))))))((((((........))))))....))))))))}((((.(((((.....))))).})))}..(((((.((((....)))).))))),(((((.(..(((.((((((....)))))).))).,)))))..,,...)))).))}.)).))))))).)))))))...)))))))))))))))))..))))))}.||||}}},}})}})......}}.))))}}}))))).}.)))))),))))))...)))).((((..,.......)))).....{(((((..{{{.,.,((((((((.(((...{(,((((((({..................}}}}}})),,,}}},,..))).))))))))))}....))))),

Transcripts

ID Sequence Length GC content
AUCACUUCGUCCCGACCCGGAGGAGGACGCGAGCCCCUUGCGGGCGGUC… 5719 nt 0.6333
Summary

This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]

Forensic Context

A study in humans demonstrated that the MRC2 was the most upregulated gene during long-term (0 to 12 months) weight loss in subcutaneous adipose tissue of weight losers, with its expression pattern showing an opposite direction in acquired obesity when validated in BMI-discordant monozygotic twin pairs [Bollepalli et al. DOI:10.1038/ijo.2017.245].