| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGUGACCCGGCGUGGCUACUAGGAGAAGGACGUACGGUCCUGCUAGUA… | 1260 nt | 0.3960 |
Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the MRPL13 was among the most highly expressed housekeeping genes with a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In a forensic context, research in contused rat skeletal muscle validated the MRPL13 as the most stably expressed reference gene for quantitative real-time PCR normalization, with the lowest stability value in NormFinder analysis and the lowest standard deviation in BestKeeper analysis, and it formed the best combination with RPL32 for multi-analysis to improve the accuracy of gene expression studies aimed at estimating wound age [Sun et al. DOI:10.1007/s00414-011-0604-3]. In a separate study in Sprague-Dawley rats, the MRPL13 was validated as a stably expressed reference gene for RT-qPCR normalization in contused skeletal muscle, enabling the accurate quantification of time-dependent wound-healing genes for wound age estimation [Li et al. DOI:10.1007/s00414-023-03095-x].