Basic Information

Symbol
MRPL13
RNA class
mRNA
Alias
Mitochondrial Ribosomal Protein L13 L13mt RPML13 RPL13 UL13m L13A L13 39S Ribosomal Protein L13, Mitochondrial Large Ribosomal Subunit Protein UL13m MRP-L13 Mitochondrial Large Ribosomal Subunit Protein UL13m
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_014078.6
Sequence length
1260.0 nt
GC content
0.3960

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-317.20 kcal/mol
Thermodynamic ensemble
Free energy: -341.81 kcal/mol
Frequency: 0.0000
Diversity: 220.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..((((((.(((..(((((((((((((.....)))))(((..(((((((((.......))))))))).)))((((.......))))......(((((.....)))))))))))))((((((((((...((((..(((((.......))))))))).((((((((.....(((...........)))(((((...))))).((((.((((((((((...........((((((.....((((((((((....((((((...((..((((..(((..(((((((((.((((.((((((...((((((((((.((.((..(((....)))..)))).)))))))).))...)))))))).....................(((((...)))))...((((((..((..(......)..))..)))))).............)).)))))))))......((((.((((.((.........(((((...)))))..((((((............((((((......................))))))...........)))))).......)).)))).))))((((((((.((((.((((...((((....................(((((((((....)).))))))).....((((((((((((.((((((((..((((.......))))..))))))))...))..))).)))))))(((((((...(((((((.(((..((((..(((((((((((.......))))))))...(((..(((((((..((((..((((((...((((((.....))))))...)))))).))))..((((.....((((..((((....))))..)))).....)))).((((((............))))))....)))))))..)))((.(((((((((....)))))))))))..............)))..))))...))).))))))))))))))(((((((.(((...((((((((.(((((.((..................))))....))).))))))))...)))))))))).........))))..)))).)))).)......)))))))..)))..))))...))...))))))....)))))..)))))..))))))...........)))))).)))).))))..))))))))...........))))))))))....))).))))))....)))))...........
Thermodynamic Ensemble Prediction
(((((..((((((.(((..(((((((((((((.....)))))(((..(((((((((.......))))))))).)))({(({{....})))}......(((((.....))))}))))))))((((((((((,..((((..{((((.....,,)))}})))).((((({{{,,..,(((...,,,,.,..}})|||||...}}}}}.((((.((((((((((........,..((((((...,.{(((((((((....((((((...{{..((((..(((..(((((((((.((((.((((((...((((((((((.{{.({,.(((....))),,)}}}.)))))))).))...))))))))....{{...........,{{.(((({...})))).,,,..((((...)))).....,..{(((((((......}}}}}}))))).))))))))}......((((.((({.{(......{{.(((((...)))))..|{{{{,............((((((......,...............))))))..,........}))))),,,,...)).}))).))))(((((((,,{(({.,(({...((((,,,{{,,{{{,...,|,,..(((((((((....)).))))))).....((((((((((((.((((((((..((((.......))))..))))))))...)),.})).)))))))(((((((...(((((((.(((..((({..{(({(((((((.......)))))))},{{((({.{,.,}}}},{{{{..((((((...((((((.....))))))...)))))).}}}}.,||||,,|..,,{{{{({{{{{,,|,}|,.},,...,,,|,,,,|||({{......,,,,..}})))}...,,,,||||.....((.(((((((({....})))))))))).,,,}}...,,),,)))..))))...))).))))))))))))))(((((((.(((...((((((((.(((.{,....,,..,,.......,..)).,,,..))).))))))))...))))))))))..,,,,...)))).,)}}),)))),).,,.,.)))))))..)))..))))...}}...))))))....)))))..)))))}.))))))..,........)))))),}))).)))).}))))))))..........,))))))))))....))).))))))....)))))...........

Transcripts

ID Sequence Length GC content
GAGUGACCCGGCGUGGCUACUAGGAGAAGGACGUACGGUCCUGCUAGUA… 1260 nt 0.3960
Summary

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the MRPL13 was among the most highly expressed housekeeping genes with a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In a forensic context, research in contused rat skeletal muscle validated the MRPL13 as the most stably expressed reference gene for quantitative real-time PCR normalization, with the lowest stability value in NormFinder analysis and the lowest standard deviation in BestKeeper analysis, and it formed the best combination with RPL32 for multi-analysis to improve the accuracy of gene expression studies aimed at estimating wound age [Sun et al. DOI:10.1007/s00414-011-0604-3]. In a separate study in Sprague-Dawley rats, the MRPL13 was validated as a stably expressed reference gene for RT-qPCR normalization in contused skeletal muscle, enabling the accurate quantification of time-dependent wound-healing genes for wound age estimation [Li et al. DOI:10.1007/s00414-023-03095-x].