Basic Information

Symbol
MRPL27
RNA class
mRNA
Alias
Mitochondrial Ribosomal Protein L27 BL27m 39S Ribosomal Protein L27, Mitochondrial Large Ribosomal Subunit Protein BL27m MRP-L27 L27mt Mitochondrial Large Ribosomal Subunit Protein BL27m
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_016504.3
Sequence length
686.0 nt
GC content
0.5452

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-241.00 kcal/mol
Thermodynamic ensemble
Free energy: -254.28 kcal/mol
Frequency: 0.0000
Diversity: 146.91
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........((((((.(((..(((((((((((((.(((((..(((....))).....))))))).....(((((((((((((((((....))))).((((((((((((....((((.((((((((.((((....((((.(((...........(((....)))..(((((..(((....((((((.(.((.((((((((.((....)).)).)).)))).)).)))..)))).((((((((((.((....)).))))))))))............)))..)))))(((((.((((.(.(((.((.((.......)).)).)))..).)))).).))))...))).))))...)))).)).)))))).))))......)))))).))).)))....((((((((..(((....((((((....((((..(((((((........)))((((.((.(((((((.(((....))).))))))))).)).))...))))))))..))))))...)))....))))))))...))))))))))).)....((((((...(((...((((((.((.((.(((..(((.((((...(((....)))..)))).)))..))).)).)).))))))..))))))))).............)))))))))))..)))))))))...........
Thermodynamic Ensemble Prediction
..,,..,,,{,(((((,{(((..(((((((((((((.(((((..(((....))).....)))))}}...{{(((((((((((((((((....))))).((((((((((((..,.((((.((((((((.((((....((((.(((,........,.(((....)))..(((((..(((...{((({((,{.((.(((({{((.((....)).)},,).)))).)).)})..}}}),((((((((((.((....)).))))))))))............)))..)))))(((({.((((.{.(((.((.((.......)}.)).)))..,.)))).),))))...))).))))...)))).)).)))))).))))......)))))).))).)))....{{(((((({,(((.{{{(((((({{..({{((,(({{.{|,}},..,})))||{{.{(.(((((((.(((....))).))))))))),,).},))})))))}))},)))))).,{||}..,}))}}))))..,))))))))))),,....((({,({{.(((...((((((.((.((.(((..(((.((((...(((....)))..)))).)))..))).)).)).))))))..))))))))).............)))))))))))..))))))))).}},....,,.

Transcripts

ID Sequence Length GC content
GAGUGAUCGAAAGCAUGGCGUCGGUGGUGUUGGCGCUGAGGACCCGGAC… 686 nt 0.5452
Summary

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the MRPL27 was overexpressed in the ventral midbrain of the methamphetamine high drinking line compared to the low drinking line, indicating its role in mitochondrial function as part of the transcriptomic basis for differential risk of voluntary methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].