| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGUGAUCGAAAGCAUGGCGUCGGUGGUGUUGGCGCUGAGGACCCGGAC… | 686 nt | 0.5452 |
Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the MRPL27 was overexpressed in the ventral midbrain of the methamphetamine high drinking line compared to the low drinking line, indicating its role in mitochondrial function as part of the transcriptomic basis for differential risk of voluntary methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].