| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGAAGGCUGGCGUAGCAGGUAAAGAUGGCAGCUACCAUGUUCCGGGC… | 2026 nt | 0.5311 |
Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. Pseudogenes corresponding to this gene are found on chromosomes 5q and 8p. [provided by RefSeq, May 2011]
A study in mice demonstrated that the MRPL49 was overexpressed in the ventral midbrain of a methamphetamine high drinking line compared to a low drinking line, identifying it as an example of a mitochondrial ribosomal protein with differential expression linked to innate risk for methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].