Basic Information

Symbol
MRPL49
RNA class
mRNA
Alias
Mitochondrial Ribosomal Protein L49 L49mt NOF1 NOF Neighbor Of FAU C11orf4 ML49 39S Ribosomal Protein L49, Mitochondrial Large Ribosomal Subunit Protein ML49 Next To FAU MRP-L49 Mitochondrial Large Ribosomal Subunit Protein ML49 Chromosome 11 Open Reading Frame 4 Protein NOF1 COXPD60
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_004927.4
Sequence length
2026.0 nt
GC content
0.5311

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-763.80 kcal/mol
Thermodynamic ensemble
Free energy: -802.64 kcal/mol
Frequency: 0.0000
Diversity: 578.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((.(..((((((..(((.(((.(((.....(((((.((((((..((.((((..(((((...(((((((((..(((((..(((((..((((....)))))).)))..)))))((((.(..(((...))).).))))(.((((((.((...........((((.((((((((..(((((((((((((((...)))))(((..((((((.((((..((((..(((((((..(((.....(((...)))..((..((((((.(((.((((.(((((((.((((.....(((((.....))))).)))))))))))...((((((((.((.....))..))).).))))((((.....))))((((..(....)..)))).(((((((.(......).)))))))(((((.(((.(((((.....((((((((((((......)).)))))))))).)))))))).....))))).((((..(((((((((........)))))))))..)))).((((((((((((.((((((((...))))))...))....(((..((((...))))))))))))))))))))))).)))))))))..))..((((((...))))))...)))..)))))))....))))(((((..(.(((((...)))))).)))))(((.......))).)))).))))))..)))((((.((.....((((((((.((((.(((((....(((((((((((((((.(..((.......))..)))))))))..)))))))))))).)))).....((((((...)))))).(((.((((((((((((((((((((((((.........)).)))))))..))))))).)))))..))).))).))))))))....)))))))).))))))))....)))))))))))))))))))))(((((((...........)))))))..((((.......))))((.(((((((((((.((((...........(((.(((.......))).)))(((((((((....)))))).....))).)))))))...)))))))).))..(((((((((((((((.((((((((((((((.(((((((........)))))))....(((((..((....)))).)))..)))))))))))))).)).))))))))).)))))))))))))...)))))((((....)))).((........)).....))))))..((((((.((.(((((((.....(((((((....((((((((....((((.(((((.(((((.((((((...))))))..)))))......(((((....)))))((((((...))))))((((..(((((.(.((((.....)))).).)).)))))))....)))))))))))))))))..)))))))...)))))))))...)))))).)))))).)))))....)))..(((..(((....)))..))).))).))).))))))......((((((((.(((((..(..((((((..................))))))..)..)))))..))))))))).)))))))))................(((.(((....(((((...)))))..))).)))....(((........)))...(((((.((((((...........(((...)))((..(((((((...)))))))..))....((((((.(((..(((((.((((((((((......................((((((((.(((((....))))).))))))))...((((((.(((........)).).))))))))))))))..........))))))).))).))))))........((((.(((((..(((..........))).)))))))))((((((((((....(((((..(........)..)))))..))))))))))...((((((.....)))))).....)))))))))))
Thermodynamic Ensemble Prediction
.((((.{((.((((((((.((..{(.((((......)))).)}))..))))))))))((((.{{({{,,.{(((((({{{.((((...(((({,,,(((((((.((((((.....((((.(((((.{..(((...))).}.))))).((((((.((...........((((.((((((((..(((((((((((((,,...,,||(((({,(({{{{.{{{{..{(((..(((((((..(((...,,(((,,,|||.{(({,(((((,,(((.((((.(((((((.((((.....(((((.....))))).)))))))))))..,{({{(({{{({..,,,}|,{|||.{|}|,,{(((.....)))),|||}.|,}}}),}))}}.(((((({.(......).}))))))(((((.{{{,(((((.....((((((((((((......)).)))))))))).)))))})).....))))).((((..(((((((((........)))))))))..)))).((((((((((((.{{{{{({,...|||}}}...}}..,|(((,,((({...))))))))))))))))))))))).)))))))))..))..((((((...))))))...)))..)))))))....}))}}))))))|.{{|||...)))})|,|,.}|{{(.......))}})))).}}}|||||||||(((,,({{...,{(({{{{,|(((,(((((....(((((((((((((((.(..{{.......}},.)))))))),.,))))))),},,),))))}},..{{{((({{{||,,,)||||}}|.(((((((((((((((((((((.......,.)).))))))},)}}))))).)))))..,,)))}),)))))}}},}}})),))))).))))))))....)))))))))))))))))))).(((((((...........))))))).{.((((((((({,,.....(((((((,{((,{,,..,{{,{,,,,,,,,|||,....|||,,.,,})))}((((({....})))))....{(((,{,,}}}..{{|||||({,.,...{((((((((((((.{.{(((((((((((((,,(({{{(........}}}}}},...,||{{{..||.,.,))))},}|,,,}}}}})))))))).}}.))))))))).))))))))))))...,,,,{{{((({{{{,,{,.({,..,,{,.|}......,,{{{.,((((((.,{{(((((((.....(((((((|{,|((((({((,..,((((.{((({{((({,.{|||||..}))})),,|})},}......(((((....)))))((((((...)))))),,{{..(((((.{.((((.....)))).}.)).))),}))|}}||))))))}}}}},}))),,}))))))..,)))))))),...)))))),|||||||}}......}})}}}||,.,(((.....,))}}|(((,{...,}..)))),.....((((((((.{((({..{..((((((..............,,..))))))..,..,})))..)))))))}..,,.|,||||,..{{||,..,})),,)})))}}...))))})},.)),,))))))))))....)))).....))))))..)))))))...})}.))))...)))).....||((..(((((((...)))))))..)}.,,.,(((((.(((..(((((,(({,,,((((.,,......,.....{{..,,,(({{((((,{((({,,..||}}},||}}||}|,,.,{{|||.||{.},},,,,)).),)})))),))))),.,,.,,.,,}}}}))))).))).))))))}}}}}|,,,}..}},,,,}}||},,,,...}}})...,{((((..,(((((((({,....{||||,,|,..,,,,,}..}}}}}.,}}||||||||...,,,,||}}},,),,,,,..,.})))........

Transcripts

ID Sequence Length GC content
ACAGAAGGCUGGCGUAGCAGGUAAAGAUGGCAGCUACCAUGUUCCGGGC… 2026 nt 0.5311
Summary

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. Pseudogenes corresponding to this gene are found on chromosomes 5q and 8p. [provided by RefSeq, May 2011]

Forensic Context

A study in mice demonstrated that the MRPL49 was overexpressed in the ventral midbrain of a methamphetamine high drinking line compared to a low drinking line, identifying it as an example of a mitochondrial ribosomal protein with differential expression linked to innate risk for methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].