Basic Information

Symbol
MRPS15
RNA class
mRNA
Alias
Mitochondrial Ribosomal Protein S15 US15m 28S Ribosomal Protein S15, Mitochondrial Small Ribosomal Subunit Protein US15m FLJ11564 MRP-S15 RPMS15 S15mt Mitochondrial Small Ribosomal Subunit Protein US15m MPR-S15 DC37
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_031280.4
Sequence length
953.0 nt
GC content
0.5299

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-326.20 kcal/mol
Thermodynamic ensemble
Free energy: -340.79 kcal/mol
Frequency: 0.0000
Diversity: 175.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((((....))))..))))((((((((.(((.(...(.((((((((((((((((((...((.....))....))))))))))))......)))))).))))).)))))))).((((.(((((((((...((((((...))))))....(((..((((.((((..(((((.((..((((((((((((((.((((((.....))))))......((.(((.((((((.((....((....))...)).)))))).)))..)).....))))))))....)))))).))))))))))).))))..))).....))))))))).))))........((((((.(((((.((((((.....(((((..((.(((.......))))).(((((((((..(((((........(((...((((........))))..((((((((.......))))))))......((((.((((....).)))))))((((..........))))((((((......(((((.(((......))).(((((((((.(.(((((.(.(((.((((.......((.....))...((((((((..((...)).....))))))))........((((........))))(((((((....)))))))...(((((..((............))..))))).(((...((((.(((..((.....))...)))))))...))).)))).))).).)))))))))))))))((.(((....(((.....)))......))).))....((((((....))))))..............)))))......))))))..)))......))))).)))))))))........)))))....)))))).....((((((((((.(((((.........))))))))))))))))))))...))))))......
Thermodynamic Ensemble Prediction
,,{({((({.,{{||||,.||||((((((((.(((.{{..{.((((((((((((((((((...((.....}}.,,.))))))))))))......)))))).,}))).)))))))).((((.(((((((((...((((((...}))))),|..(((..{(({.(({{,.(((((.{(,.((((((((((((({.((((((.....))))))......{{.(((.((((((.((....({....}}...)).)))))).)))..}).....,)))))))....)))))).}}))))))))).))))..))).....))))))))).))))........{{{{,..|||||,||||||}}...|||||,.{{.(((.......)))}}.(((((((((..(((((........(((...((((........))))..((((((((.......)))))))).,....((((.((({....}.)))))))((((..........))))((((((......(((((.(((......,,}.((((((((({(.(((((.(.(((.((((.......((.....))...((((((((..{{...}}.....))))))))........((((........))))(((((((....})))))),..(((((..(({...........))}.)))))}{{{,..{{{,{(((..({.....))...))))))}...})}.)))).))).).))))))))))))))){{.(((....(((.....)))......))).))....((((((....))))))..............)))))......))))))..)))......))))).)))))))))......,,}||||,...|},,}}|,{{.((((((((({((((((.,.....,.))))))))))))))),))))..,))))))},,...

Transcripts

ID Sequence Length GC content
GCCUCGAUUGGUCGAUCCUGGGCCAGCAUGGCGGCGCCCAUGUAACCCG… 953 nt 0.5299
Summary

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S15P family. The encoded protein is more than two times the size of its E. coli counterpart, with the 12S rRNA binding sites conserved. Between human and mouse, the encoded protein is the least conserved among small subunit ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 15q and 19q. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that a 7-day overfeeding intervention induced significant up-regulation of the MRPS15 gene, which is involved in translation, in abdominal subcutaneous adipose tissue from male subjects [Shea et al. DOI:10.3945/ajcn.2008.25970].