Basic Information

Symbol
MRPS25
RNA class
mRNA
Alias
Mitochondrial Ribosomal Protein S25 MRP-S25 RPMS25 MS25 28S Ribosomal Protein S25, Mitochondrial Mitochondrial 28S Ribosomal Protein S25 Small Ribosomal Subunit Protein MS25 DKFZp313H0817 FLJ00023 S25mt Mitochondrial Small Ribosomal Subunit Protein MS25 COXPD50
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_022497.5
Sequence length
4572.0 nt
GC content
0.4709

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1541.50 kcal/mol
Thermodynamic ensemble
Free energy: -1622.14 kcal/mol
Frequency: 0.0000
Diversity: 1129.19
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((..((.(((..(((((..((((((((.(((((((.....))))))).....((((.((..((((((.((.((.(((..(((((((((((((((..((((..((....))..)))).....)))))...)))))))((((.(((((((((...(((((............((((((.(((.((((((..((((..(((((...((((....)))).......(((.((.(((...((((((....)).))))((.((.(((........))).)).))................))).)).)))....)))))..))))..)))))).)))...)).))))((((..((.(((....))).))..)))))))))...))))))))).)))).((((((........((..............)).......)))))).......(((((....))))))))..))).)))).))))))..))))))))))).))))))))..))).)).))))...(((((.((...)).)))))....(((((((((..(((((((...)))))))..(((((((.((....(((((((((.((((((((..((((..((((((((....((((((((((....(((..(((((((((...)))))))))..)))...))))))((((((((((((..........(((((...((((((((((((....)))))).((.(.((((.....((((.(..((((((((((((....(((..........))))))))))))))).).))))...)))).).))(((...))))))))).....)))))..))))))))))))...............((((((((((...((((.(((((.(((((.(((((..((((((.(((.(.((((((((.((.(((((.((.((((..((((....))))......)))).))..)))))...)).))))).))).)...))).))))))...)))))..))))).......)))))..))))..))))))))))))))))))..)))).((((((((.......))))))))))))..)))))...))).)))))))))((.(((((...))))))).((((....)))).(((((((((((..((((((.((.(((((........((((((((..((((((((.(((...(((((((..(((((.(..((((((((((((((.((.((((.......(((......))))))).)).)))))))))))((...(((((((((((((.((.(((......))).)).)).)))..)))))))).))......((.....)).(((((((....))))))).(((....))))))....).)))))..))))))).)))))))))))..(((((.((((...))))((((((((((((((((((.((....)))))).))))))((((((........))))))((((....(((.((((((((((...)))))))))).))).))))))))))))....(((.((((((((((((....)))..)))..)))))).)))((((((((((((((((((((.(((.....((((((....))))))))))))..(((((..........)))))((.((((((((((.((((.(((.....(((((....)))))..(((.....)))..........((((((((((....))))))))))..((((((....)))))).))).)))).))....))))))))))(((.(((((.((.(......).)).))))).))))))))))))).)))))))))))).))).)))))))))))).))))))..((((((.......))))))......(((((..(((((......(((((.((.((((......(((.......))).((((.(((.....))).))))..((((((((......((((.((((.....((((..(((((....)))))..))))...)))).))))..))).))))))))))).)))))..)))))....)))))((((........))))((((((..((...((((((((((((...))))))))...((((((((((.((((.((((...(((....))).......(((((.((((((.((((.(((((((..((((((((((((((((....((.........)).....))))).))))))))((((...))))..(((..(((((((.(.((((((((((...((((.((((((..((((((((((.............((((((((((((((..((((.....))))..)))))..................))))).))))))))))))(((((((....(((((((.((.....((((((.......)))))))).)))).))))))))))..)).)))))).)))).)))))..))))).).)))))))..)))...((((..(((.((.....)).)))..))))......((((((....((...))....)))))).......)))..))))))))))).)))))).)))))..((((((.(((.(........).)))))))))......((((((((.....((.((((((((((((((((((.(((((((...))))))).((((((.......))))))(((((....)))))............)))).))))))).......((((.(...(((((.((.......)).)))))..)))))..(((((.(((.(......).))))))))(((((((((((((((((((((.((....)).)))))))))..(((((.....((((((((...)))))))).....))))).(((((.((((.(((((..((((....(((((((((((((((..(((((((((((((......))))).)..)))))))))))))))..............)))))))........(((((.((((...((((....))))....)))).))))).....((((.((....))))))......((((((....((((.((.....)).))))....))))))(((((..(((((......(.......)......)))))))))).))))....))))).))))...))))).((.((((((.(((((((....))).)))).)))))).)).)))))))))))).))))))).))..((((((.....(((((((...((((..(((..((((......))))))).))))....)).)))))......))))))(((((((.((((((.(((..(((((.....)))))))).))))))..........((((((((((((......((((.....))))....))))))))))))(((.......))).((((......)))).....)))))))))))))))..((((.((((((............(.(.(((((..(((((((...((.(((((.....))))).))(((((((((....)).)))).))).(((...)))................((((.(((((.(((.((((((......))))))))))))))..)))).)))))))))))).).)...)))))))))).))))))))..)))))))))))))).)))))))))))))))))))......)).)))))))....))))).))))(((((((((((....((((..((((((((((.(((((.......(((((((.(((..((((.....)))).))).)))))))......((((........)))).....((((((....)))))).)))))))))..))))))))))...................................((((((....))))))..(((((.((((.(((((((..((((.....))))..(((.(((((((..(((((.(((((((...(((((.((((.....)))).((((((((((......))))))))))..((((((...))))))...(((.((((((((.(((..((((......(((((.((((.(((((.((((((...(((.....((....))...)))...)))....))).))))).))))))))).(((((....)))))))))..))).)))))))).)))....(((.......((((((.......((((((.((((..((((((...(((.(((((....((((....))))))))).)))....))))))..)))).))))))..........)))))).......)))...)))))...))))))))))))..(((((((........)))))))(((((((..........))))))).......))))))).)))((((....))))..((((.....))))...((((((......)))))).)))))))...)))))))))(((((....))))).)))))))))))..
Thermodynamic Ensemble Prediction
.((((..((.(((..((((,.{((((((((.(((((((.....))))))).....{(((.((..((((((.((.((.(((..((((((((((((((({.((((..{(,...})..)))),,...)))))...)))))))(((((((..((((((.((((((.........)},))))....)))))).....(..((((((((...{(((,...|||,.......},|{||,|((((,..(((.((.(((({{{{{...{(((((((,,(,,,,,....,,,||,,.,}}}|}}}...,})))},}...,,||,||}|}}}.,,,))))))))))).)).)))})))}},|..(({.((((..{((({(|...((.((((....)))).))....)),}))}...)))).})}))))))))..)...,{{....}}})))))))...(((((....))))))))..))).)))).))))))..))))))})))).))))))))..))).)).))))...(((((.((...})})))))....(((((((((..(((((((...)))))))..(((((((,((....(((((((((.((((((((..((((..((((((((....{(((((((((,{..(((..(((((((((...)))))))))..)))..}))))))((((((((((((..........(((((...((((((((((((....)))))),{(.{.((((.....((((.,..((((((((((((....{((..........}}})))))))))))).}.))))...)))).).}}(((...))))))))).,...)))))..))))))))))))...............((((((((((...((((.(((((,(({((.(((((..((((((.(((.(,((((((((.{{.(((((.((.((((,.((((....))))...,..}))).))..)))))...}}.))))).))).},,.))).))))))...))))),,)))))}}.....,,)))..))))..)))))))))))))})))}..)))).{(((((((.......)))))))))))).,))))),..))).,))))))))((.(((((...))))))).,{||,..,|||,.(((((((((((.{(({{{{.{{.{((((........((((((((.{((((((((.(((...(((((((..((((,.,..,||(((((((((((.((.((((.......(((......))))))).)).))))))))))){{...(((((((((((((.((.(((......))).)).))}},)..)))))))).)}........{{((((({(((((((....))))))).((({...,))))}.})))))))))..))))))).))))))))))}))|((((.((({...})))((((((((((((((((((.({....})))))},))))){(((((........)))))}{{{{.,..{((.{(((((((((...)))))))))}.))).}))}))))))))....(((.{((((((((((({...))),.}))..)))))}.)))((((((((((((((((({((.(((.....,((((|....})))))))))))..(((((..........))))}{(.((((((((((.{(({.({{..,,.{({{{..,,|||||,,{{{.....}|,.......,||{{({{{{{{{..,,||||}||}||..((((({....}))))).))}.)})).}},,,.)))))))),,(((.(((((.{{.{.....,..,}.))))).))))))))))))).)))))))))))}.))).)))))}}))}}}.}}||||....,{||,,,....||,,,,..,,,,{{{{{..((((({,,(({(((({.((.((((..,...(({,{,.{,{|.,.{{{{.|||,..,,))).)))}.,{{{({{({|,....{{{{..,{{{{...((((..(((((....)))))..}}}|...}})),)})),},,,}))))))))))).))))),|}}}}}....}}}}}||||},},..,}))))||||,|,|{|...,{((((((((((...)))))))).}}{(((((((((.((((.((((,...,,.{{{{,,.{,,,,.{((((.((((({.(((,,(((((({..({{{((((((((((((.,..((,........))..,..)))))))})))))}{(((...))))..(((..(((((((.(.((((((((((...((((.((((((..((((((((((,.,,,{{....,{(((({{,{((((((,,(({{...,,)))}..)))))|,}||,..,,,......,))))),,)))))))))))(((((((....(((((((.((.....((((((.......)))))))).)))).))))))))))..)).)))))).)))).)))))..))))).).)))))))..))}...((((,,(({.((,,,,,}|,|||..}}||,,,...((((((.,..({...||,,,,))))}},,..|,.}}),.}))}}}}}}}}.}})})).)))))..((((({.(((.{........}.)))})))))......{||(((({...{|{(,((({{{{((((((({{{|,{((((((...))))))},((((((.......)))))}(((((....))))).,....,,.,.,}))).))))))),......{{||,||..{{{||,||.,,,,,,)}.)))))}.|}}}}..(((((.{{({,...,..}||}|)))))((((((((((({(((((((((.((....)).))))))))).,(({{{.....((((((({...}))))))).....}}})}.(({({.{{{{.{{{{{..((((.,{{{((((((((((((((..((((((({(((((......))))).)..))))))))))))))),.....,,....,}}))))}},,,|,,,,{((((.((((...((((....))))....)))).)))))}}},.,{{,{((....))))}}......((((((....((((.{{.....,,.))))....)))))),||{{,.{({{{,.....,......,),,,...))))))}})),)))}...,})))}.}})),,,))))).((.{(((((.(((((((....})}.)))).)))))}.)).})))))}}}))).))))))).))})||((((.,...((((({(,..((((..(((..((((......)))}))).))))....)).)))))......))))}|(((((((.((((((.(((.,(((((.....)))))))).))))))..........((((((((((((......((((.....))))....)))))))))))}(((,.....,||}.,{{|,....,)))}.....)))))))))))))))..|||{,|(((({{{|,,,.,,.,,|,|,{(({{..{{((({({{{(.{(((((.....})))}.}}|}}|||,||....}}.}))}|,}}}|{|,..}||,,,...||........{{{|,(((((.(((.((((((......))))))))))))))..)))).}))))))))))).)}}))}))))}))))}.))))))))..))))))))))}},,...,,,,}.))))))))))).....,)),)))))))....))))).)))}(((((((((((....((((..((((((((((.(((((.......{((((((.(((..((((.....)))).))).))))))}......,,,{,,,,...,)))).....((((((....)))))).)))))))))..)))))))))).........................,{,,..,{{{({(({,,,,,||||},.,{{{,..,{{{.{{{,,||},||||||,|||}}..,}}..,}}}}},..(((((.(((((((...(((((.{{((....,}|},.((((((((((......))))))))))..((((((...))))))...,,,.((((((((.(((..((((......(((((.((((.(((((.((((((...{({.....{,....}}...)))...)))....))),))))).))))))))).(((({....}))))))))..))).)))))))).},,..,.{{{.......((((((.......((((((.((((..((((((...(((.(((((....((((....))))))))).}))....))))))..)))).))))))..........)))))).......}}),..)))))...))))))))))))..(((((((........)))))))(((((((.,......,.)))))))|{{{{..,,,{|||,,,..,|}}}}}},,).,||||.....}}}}.,.((((((......)))))).,}}||||,,,,},|||,,,,,,||...}))))),)))))))))))..

Transcripts

ID Sequence Length GC content
GCGGGAAGUGGAACCUGGCUCUGGGGAGAAGCCGCGUGAGAUCCGCGCG… 4572 nt 0.4709
Summary

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Forensic Context

A study in humans analyzing leukocyte gene expression profiles from severe burn patients identified the MRPS25 as a top sustained decreasing gene (SDG) with expression declining from the healthy state through the late recovery phase (>400 hours post-injury), classifying it as a core biomarker for burn recovery [Xu et al. DOI:10.1159/000493451].