| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUUCGCCGCCUGGGAGCCGUCCGGCGCAGCAGUUUCUAGGUCCCCAC… | 931 nt | 0.4748 |
Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S6P family. Pseudogenes corresponding to this gene are found on chromosomes 1p and 12q. [provided by RefSeq, Jul 2008]
A study in human postmortem dorsolateral prefrontal cortex demonstrated that MRPS6 expression was lower in individuals with major depressive disorder compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130].