Basic Information

Symbol
MRPS6
RNA class
mRNA
Alias
Mitochondrial Ribosomal Protein S6 MRP-S6 RPMS6 C21orf101 BS6m 28S Ribosomal Protein S6, Mitochondrial Small Ribosomal Subunit Protein BS6m S6mt Mitochondrial Small Ribosomal Subunit Protein BS6m Chromosome 21 Open Reading Frame 101
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_032476.4
Sequence length
931.0 nt
GC content
0.4748

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-275.10 kcal/mol
Thermodynamic ensemble
Free energy: -293.00 kcal/mol
Frequency: 0.0000
Diversity: 233.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((..(((((..(((...)))..))))).)))..(((((((((((((((((((((.((((((..(((.((((((((..((((....((((.(....).))))(((...(((.........))).)))))))..)))...(((((((.......))))))).(((((((.......)))))))(((........)))))).)).)))...))))).).).)))....))))).))))))))))))....((.(((((..((((((((((....(.((((((((((....((.((((.((((((..((((.........((((.((....)).))))..))))..))))))...)).)).))((((....).)))........((((((.((((((((..............))))))))....((((.........(((((.(((((((...)))))))..)))))...........))))........((((((...(((((.(((.((....)).)))...)))))......)))))))))))))))))))...))))...)))))))....)))..))))).))((((((((((((((.((((((.(.((((..(((((....(((((..........)))))......(((((((.((((((((((((.(((((......((((.....)))).....))))).))...((((((....)))))).(((((((...(((.((......)).))))))))))........((((....))))..))))))))))..))))))).(((((((..((....))..)))))))..)))))..)))).).)))))))))))..........((((.....))))...)))))))))....((((((.((((((.....))))))..)))))).
Thermodynamic Ensemble Prediction
(((,,(((((,,{(({..}}},,))))},}}}.,(((((((((((((((((({({.((((((,,(((.,,{{{{{{..{|(|,..|||{((({,..,.))))|{,.,.{{(..,,,..,,||}.,|||}}|,{||}.||(((((((.......))))))).(((((((,....,.)))))))|,,........)},))}.,).))),..)}})),}.).))},..}))))).)))))))))))).,|||(,{{{{(.,({{(((((((...,{.{{{(((((({...,((.({({.((((((..((((.........((((.((....)).)))),.))))..))))))...)).)),))}.||,{,{{{||}..,....,{{(({(,((((((((.....,,....,,,))))))))....((({.,,......(((((.(((((((...)))))))..)))))......,,...}))}........{{{{{{..,(({{{,{{{,||,,..}),})}.,})))}}.,,,..}}}}}}}))))})))))))...))})...)))))))....)))..))))}.)){((((.{..(((((.((((((.(.((((..(((({...,,((((,.........))))),.....(((((((.((((((((((((.(((((......((((.....)))).....))))).))...{(((({....})))),.{,,,{||,,{(((.((......)).))))))||},...,,,..{(((....)))}..))))))))))..))))))).((((((({.((....)).})))))))..}))))..)))).).)))))))))))..}.))))}.,,,,....,||||,,..,}}.}}},}...{{{{{{.{{{{({.....)))))}..)))))}.

Transcripts

ID Sequence Length GC content
GCUUUCGCCGCCUGGGAGCCGUCCGGCGCAGCAGUUUCUAGGUCCCCAC… 931 nt 0.4748
Summary

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S6P family. Pseudogenes corresponding to this gene are found on chromosomes 1p and 12q. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human postmortem dorsolateral prefrontal cortex demonstrated that MRPS6 expression was lower in individuals with major depressive disorder compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130].