Basic Information

Symbol
MSMB
RNA class
mRNA
Alias
Microseminoprotein Beta PSP-94 PSP94 IGBF PN44 Beta-Microseminoprotein PSP57 MSPB PRPS MSP PSP Prostate Secretory Protein Of 94 Amino Acids Prostate Secreted Seminal Plasma Protein Seminal Plasma Beta-Inhibin Immunoglobulin Binding Factor Immunoglobulin-Binding Factor Microseminoprotein, Beta- HPC13 PRSP
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_002443.4
Sequence length
486.0 nt
GC content
0.4403

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-125.00 kcal/mol
Thermodynamic ensemble
Free energy: -134.16 kcal/mol
Frequency: 0.0000
Diversity: 163.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((....((.(((((.((((((((((((..(((((....))))).)))))))))........(((((((.....((((.((((((...))).))).))))....)))))))..((((..((((((((..((.....))..))))))))...)))).....(((((.(((.(((.(.(((((((((((.(((..(((((((((......(((.((((((......))))..)).)))....)))))).)))..))).)))..............)))))).....(((((......))))))).).))).))).).))))...))).))))))).....))))((((((.......))))))...........(((((((.(((((((...((((...((((((((...........))))))))...((((((...))))))..)))).))))))).)).............)))))..
Thermodynamic Ensemble Prediction
.....,((((.,..({,(({{{.{{|{((((((((..(((((....))))).))))))))},{{((((((((((({.....((((,({{(({...})).}}},||}}....))))|||.{((((..((((((((..((.....))..))))))))...)))}.,...|.|||......,.}}}}}|||||((((.(((..((((((((({{....{((.,,{{{,..,...,}}).,))})))....)))))).}))..))).)))}..,.,..,}},..,|||}.,{{,,{((({...,,||}||}||||,.,}..|,,}|)))||{{||,.{||,||,.....,|,,((((((.......))))))....,,,..{{(((({...,,||||}}}.((((...,||||,||}}}..}}}}}}.}||||,,...{(((((...))))))}.}))).}}))),},|}....,}}})},}}},))}..

Transcripts

ID Sequence Length GC content
GUACCUGUCUAUAAGGAGUCCUGCUUAUCACAAUGAAUGUUCUCCUGGG… 486 nt 0.4403
GUACCUGUCUAUAAGGAGUCCUGCUUAUCACAAUGAAUGUUCUCCUGGG… 380 nt 0.4421
Summary

The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans validated the MSMB as a novel semen-specific mRNA marker via RT-PCR and qRT-PCR, demonstrating high specificity and sensitivity in a multiplex assay [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. Another study in humans and 24 non-human species further validated the MSMB within a pentaplex for seminal fluid identification, where it detected seminal mRNA in post-coital vaginal samples for up to six days, though it showed relatively higher transcript abundance in non-target body fluids like vaginal material and was detected in some primate samples [Albani & Fleming DOI:10.1016/j.scijus.2019.01.001]. Beta-microseminoprotein is a protein marker found in seminal fluid for body fluid identification in human forensic investigations [Alex et al. DOI:10.1016/j.scijus.2025.101320].