| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUACCUGUCUAUAAGGAGUCCUGCUUAUCACAAUGAAUGUUCUCCUGGG… | 486 nt | 0.4403 | |
| GUACCUGUCUAUAAGGAGUCCUGCUUAUCACAAUGAAUGUUCUCCUGGG… | 380 nt | 0.4421 |
The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
A study in humans validated the MSMB as a novel semen-specific mRNA marker via RT-PCR and qRT-PCR, demonstrating high specificity and sensitivity in a multiplex assay [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. Another study in humans and 24 non-human species further validated the MSMB within a pentaplex for seminal fluid identification, where it detected seminal mRNA in post-coital vaginal samples for up to six days, though it showed relatively higher transcript abundance in non-target body fluids like vaginal material and was detected in some primate samples [Albani & Fleming DOI:10.1016/j.scijus.2019.01.001]. Beta-microseminoprotein is a protein marker found in seminal fluid for body fluid identification in human forensic investigations [Alex et al. DOI:10.1016/j.scijus.2025.101320].