Basic Information

Symbol
ABL1
RNA class
mRNA
Alias
ABL Proto-Oncogene 1, Non-Receptor Tyrosine Kinase JTK7 P150 C-ABL ABL V-Abl Abelson Murine Leukemia Viral Oncogene Homolog 1 C-Abl Oncogene 1, Receptor Tyrosine Kinase Abelson Tyrosine-Protein Kinase 1 Tyrosine-Protein Kinase ABL1 Proto-Oncogene C-Abl EC 2.7.10.2 Abelson Murine Leukemia Viral Oncogene Homolog 1 ABL Protooncogene 1 Nonreceptor Tyrosine Kinase C-Abl Oncogene 1, Non-Receptor Tyrosine Kinase Proto-Oncogene Tyrosine-Protein Kinase ABL1 BCR/ABL1 E1a2 Fusion Protein BCR/ABL1 Fusion Protein E3a1 Bcr/C-Abl Oncogene Protein Chimeric BCR::ABL1 Protein BCR::ABL1 Fusion Protein BCR/ABL E8a2 Fusion BCR/ABL1 Fusion BCR-ABL1 P190 EC 2.7.10 BCR-ABL Bcr/Abl CHDSKM C-ABL1 V-Abl
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_005157.6
Sequence length
5578.0 nt
GC content
0.5929

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2295.00 kcal/mol
Thermodynamic ensemble
Free energy: -2387.77 kcal/mol
Frequency: 0.0000
Diversity: 1657.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.((((.((((..(((.(..((((((((.((((.(((((.((......)).))))).)))).(((((((.(((.((((((((.(((((...((((((.(((.((((((((((((((((..((((....)).))..))))))).(((.((((.((((((((((((((((((((((.(((....))))))).....(((((.(((((((((((.(((((((((.......(((..((((((((....((((..(((((((((((..((((.(((((.......(((((.....((.((.((((((((...)))))))).))))...)))))((.((((....)))).))....))))).((((((((((((......(((((....(((((((((......((((......(((..((((.......)))))))..))))......)))))))))....)))))...((((((........((((.............))))........))))))...)))))))))..)))............))))..))))).))))))...((((((..((((((.(((((..((((((((......(((.(((....))).))).)))))).))..)))....)).))))))..).)))))...((..((((((((....(((((((((((((.....((..(((((((.((.((......)).......((((((((((.(((..(((((.((.......))))))).)))))...(((.(.(((((((.(((((.((.....(((.((((.((((.(((((((.((..(((((((...(((.(..((((.....((..(..((((((((((((((((((((((((((.((......)))))).............))))).))))))..)).)).)).))))).)..))......))))..).)))...)))))))..)).))......))))).)))).)))))))(((((((.((((((..((((((((.((((...((.(((((..(.((........)).)..))))).))...)))))))...)))))...)))))))))))))....(((((((..(((((((....(((....)))......))...)))))...))))))).(((((..(((.(((....(.(((((.(((((...((((((.(((....))))))))))))).(((((((.........((....))((((((((.....)))).))))..)))))))).))))).)..))).)))))))).)).)))))))))))).).)))...(((((..(((((((((((((((.....((((((((......((((....))))...((((((..((((.....((((((......((((((.((........)).)))))).....)))))).....)))).)))))).....((((.((((.........)))).))))))))))))((((.((((.........)))).)))).....(((((..(((..(((((..(...(((.(((((.....))).)))))..)..))))).....)))..)).)))..((((((((.((....)).))).))))).(((((((.......(((((...(.((..((.((...((((...))))...)).))..)).)...)))))))))))).((((((...(((((((.((((((.((((.((((...)))))))).)))(((.(((((((.((.....(.(((((((..(((((((.((((.((((..((......))...)))).((((....))))(((....((((((((.((......)))))))).))..))).)))).)).)))))...((((.........))))))))))))..)).)))))))))).......))).))))))).)))))).............)))))))))))).)))..))))).........))))).))).....)))))))))...))...)))).((....))))))))))))))))...)))..))(((((((..((((.((((((((((((((.(((((((...((((..(((((((((((((((..((((...((((...))))...))))....(((((.......)))))))))(((.....)))((((((((((((.((((((((....)))))))).)))))..((((((((..((((((.....((((...(((.((((((..(((.((........))..))))))))).))).)))).(((((.....)))))...((((((..((((..(((((....)))))..))))..)))))).((((.((((...)))))))).))))))....))))))))..((((((...))).))).......)))))))......))))).))))))(((((((((....)).))))))).......((((.........)))).(((((........)))))))))...))))))).....(((((.((..((((((((((..((((....))))....(((((((.((...((((........))))...)))))))))......((((((((((.(((.((.((((((((((.(((((((((.(((..(((((.....(((((...((((.(((((((.((..((((((.((((.(((((((.((................)).))))))).)))).))))))...)).....((((.((.....)).))))........))))))).....((((.(((......)))))))((((((.......)))))).(((........))).....))))...)))))..))).))..))).)).(((((((.....)))).))).))))))).)))).)))(((.(((..((((((((((..((((..(.((..(((((......)))))..)))))))..))).)..))))))...))).))).((((((((.((((........))))...))))))))...........))).))..)))..)))))))))).....)))))))..))).))))))).......((((....))))...)))))))))(((.((...)).)))..)))))..))))....)))))))..........)))).)))))))))))...))))))))).).))).))))))).)))))((.(((((..(....)..)))))))....((((((....((((((((.((.(((((((((.((....)).)).))))))).)).)))))))).))))))..))))))....))))))).(((((...))))).(((..((((...))))..)))...((((((....((((((..((((((.((((.........(((((((....)))))))..(((...((((((((..((....)).)))))..))).))))))).))).))).....))))))))))))....((((..(((...(((.(.(...(((((((.((((((((.((((.((((..((((...(((((((..(.((((....)))).)..)))))))))))...)))).))))....)))).(((((((((....))))....)))))((((...((((((((.....))))))))..))))...(((((((...)))))))...)))).))))))).)))))...)))..))))......))))).)))).)))((((((.((((...........(((((....)))))..((.((((.(((((((.((((((..(((((((((....((((((((.(.(((..(((......)))...))))))))))))..)))))..))))..........................(((((((..((......))..))).))))...(((((.((((...)))))))))((((......)))).....(((.(((((.....))))))))..))))))..)))).((.((((((((............(((((((((((...(((((((((((((....))))))....(((.((((((.((((((.(((((.(((((.(((((((...((((((....((((((((.((.(((((....))))))).)))).))))....)))))).....)))..(((((((.(((.....(((((((((((((((...........(((.(((((.((((...............)))))))))..))))))))))((((((...((((.((((...((((..((((.((......(((((...)))))..)).)))))))).(((((((((....(((((.((((.((.........)).))))...))))))))))))))..(((((((...(((..(((.((.......((((((((((((((..(((....)))..)))))))).(((((.......)))))...)))))).(((((...)))))(((((((..(((((((...((((........))))........((((((((((((..(((((.(((.((......))..)))..)))))((((....))))....(((((((.(((((((..((((.(.(..((.......))..).).))))..))))))).)))))))))))))))))))((((((........))))))........(((((((((..(((((..(((((.......)))))))))).))).)).)))).)))))))......)))))))...((....))......)).))).)))...))))))))))).)))))))))))))))))).......))).))))))))))).)))((((((((......)))(((((...(((((..(((((..(((((....))))).))))).))))))))))..)))))))))))).))))))))))))))).....((((((.(....)..)))))).))))))).............((((.((((.((....)).))))))))...(((.....)))....................((((.....))))((((((((((.....))))))))))))))))))))).)))))))).)).....(((((((..(((((((...)))))))..))).)))).........))).)))))))))).)))))).....)))))).))).))))))))).))))).))).(((.(((((((.((......))..........(((......)))............))))))).)))(((((((.........((((((((....))).))))))))))))..)))))))))))))))...(((((((......))))))).))))))))..).)))....)))).................(((......(((.(((....))).))).....)))..(((...(((((...)))))...))))))).)).......
Thermodynamic Ensemble Prediction
{{.{((((((((((((((......))).)))))|,||{{((((.{(.(((({{{(,|{|{|{{(((((((.,{{((((((((..((((((({,(((((.({((((((((((,((((,(({.{{((({,,{{.||,})))))))||((((((((((({((((((((((((((,(((.((({,{,|||||||....,(((((.((((((((((,,((((((((({,{{...{((..,,.((((({(({{({.,,(((((((((((..((((.,({{,..,,}}{(((((.....((.((.((((((((...)))))))).))))...)))))|{.((((....)))).},....}}},,.((((((((((((......{{{{{,,,,,{{{{{||||,,,..,.,,....,,{{{{{{,{((((....{{||,|.,|,....},...)))),,,,,}}}}||||}{{,{(((((..{{....{{|{..,}}}}.}}}.}))),........,))))),..)))))))))..)))............))))..))))).))))))...((((((..((((((.((((({,((((((((..,{{,((,,({,..,.))},,)),))))))},,..}))}},}}}.))))))..).))))).|,({|{({((({{,.,.,(({((((((,(({.,...,..,|{||{{{||,,||.,..|||},......|})|||||||,{((..(((((.((.......))))))).}||||,..{{(.(.(((((({,(((((.((.....((,{((((.((((.(((((({.((.{((((((({..{({{(..((((...,.((..(..(((((((((((((((((((((((((,,((......))))))...,{.....},.))))).)))))),.}).)),,).))))).),.))..,,..)))).}).)}}...))))))),})}.),.....}))))).)))).))))))}(((((((.((((((..((((({((.((((...((.{((((..,.((........)).}..))))}.))...))))})}.,,)))))...))))))}))))))....(((((((..(((((,,....(((....,}}....,,))...)))))...))))))).(((((..(((.(((....,.(((((,(((((...((((({,(((....))))))))))))),(((((((.,......,|{....,}{(((((((.....)))).))))..)))))))}.))))).}..))).)))))))),}),)))))))))))).).)}|,|{({(({..(((((((((((((((,,...((((((({....,.((((....)))),..((((((.,((({.....((((((......((((((.((........)).)))))).....)))))).....}))).)))))).....{(((.((((.......,.)))).))))}))))))),{{{.{|{,,|.,,,,,}))}),)))}.},.,|||||,.{|{.,|{||{.,|.,.{{{.|{|||,,...))),))))),.}..))))).,...))).,)).))),,||{||{{{,||,..,)),))).))))).{||{((({{{....{{{,,,.,{|({,.({.,,...{(({.,|},,|,{,,}.|||.}|,,||,|)))}}}}}}}}.((((((...(((((((.((((((,((((.((({...)))))))),))){((.(((((((.((..,..{.(((((((..((((({(.((((.((((.,{{.,,...},...)))}.{(((....)))}{{{,,.{(,((((((,{{......)))))))).)).})}).)))).)).)))))...((((.........)))))))))))}..)).)))))))))}.......))).))))))).)))))).............}}}}}}}}}||}.}}}.,))})),}..,..||,||||||||,,,,..,}}||||}....|{..,,}}.{{....)})))}}||||||},||,|||||||,{((((((..((((.(((((((((({(((.(((((((...((((..(((((((((((,(({,,(({{...((((...))))...|}||{{..{((((,....,.))))))))),|{},,..)),((((((((((((.((((((((....)))))))).)))))..((((((((..((((((.....((((...(((.((((((..(((.((........))..))))))))).))).)))).(((((.....)))))..,((((((..((((,.(((((....)))))}.))))..)))))),((((.((((...)))))))).))))))....))))))))..((((((...))).))).......)))))))......)))))))))))){{(((((((....}}|||)))||,......((((...,,..,,}})).(((((........)))))}))),..))))))).....{{{{(.((..((((((((((.,((((....))))....{((((({,((...((((........))))...))))))))}......{{{{(((({{.(({,|{,{{((({((((,((((((({({,,{,....))..,..(((((...((((.{{{||||.{{,.((((((.((((.(((((((.((,.....,....|....)).))))))).)))).)))))),,.}}.,,..||||||{.{{,.||.|}||,{,..((((((((....)).))))))||.,.}.|}.,||{|||{...((((....,|||(((({.....|||}|||}||,|||},..}}}}|,({(((({{.{||..||||,{,{{..,,}))))})))})))))}).}})).))}||{.|||.,||{||{||||,,|{{..,(.({..{{{{{...,,.)||||,.||||}}}..))).},.|||}}}...)}).))}.((((((((.((((........))))...)))))))).........},))).)},.})}..}}})}})))),..,.)))))))..}))})))}})),,,,,..{,{(|...}})),,,))))))))||||,||,,.}).))),})))))..))))..,.))))))}.........{||||.},,,}}))))....})))))))},|,|)).))))))).)))))||||{|,.,.|,..,|||}}.))})}}}.{{{{{{....((((((((.((.(((((((((.((....)).)).))))))).)).)))))))).))))))}.))))))....,,))))}.,..(((({.{{{..(((..((((...))))..)))..}}}.|))}}.{((((((..((((((.((((.........(((((((....)))))))..(((...{{{(((((..((....)).)))))..})}.))))))).))).))).....)))))))}))))))))))),{.,,...,,,.,,,,...(((((((.((((,.{{.((((.((((..(({(...(((((((..{.((((....)))).)..)))))))})))}..)))).)))).|}.||||{(..,,..,,..,..))))}}.}}},(((((...((((((((.....))))))))..)))))..(((((((...)))))))...)))).)))))))})).})))))))))).)}...,.,,})))}))))))}).))))))}}|.......,|,,{(({(({.{{||{{,{{{((.(((((((((...((((((((..((((((((..(((((((((.(((((((((....{((({{,{{|||((||||||..}),))).).))).}}}.......,....||{((({{{.(({((((..((......))..)))}})))..{(((((.((({...)))})))))},,,,....((((((..{.(((.(((((.....))))))))..,..)))))){(((({,((((((({,,(,..,,||,,,,|,,,||}}}.,)|||,||{|||||{,,,,)))}}}...,(((((((({((((((((({{(({,{{||..||||}|||||((((((....{(((({({.{{.(((({....}))))},.}}}}.)))}....)))))}....{{...|||}||,,(((((.(((((...(((((((.((.{{{(((.,{.{((..,.,}),}))))))).)}.)}.)))))...))))).))))}((((..(((.((((((.{.,,.{....,,...,.}.)))))).)))..)))}.,,.||{((((({{,,..}|||||||,,,},,}||||{}|||||||,,..,)),))})))))}}.|.{(((((((.((({{((((((.({....((((.((......)).)))).((((((((..(((....)))..)))))))).(((((.......|))))......|{|.|{{{|,..)))))|||.,,,.}}))))))}..{{,,,{,....{{,|,...,},.,((((.((((((...})}|.,}}...)))}}.{|||.,,,)))}..{((({....))))})))))))))))},||||}}}}|||,}})))}}},.,)))))....)}))),..,,,,)))}))))))))),...)))}}))))..)))))))).))))))))}.}}}.((({{((((..(((((..{({{{.......}))}}))))).))).}}.)}}}{(({(((|{..{(((((.,|{({.{,....}}....,,,,..,)))))}..,))))}},....,},||||||||||||}||,{{{.{,{|,,},|||||||,|,}}}||}||{{{,,,,..},))))}|}}.|||||}}{{(((.,{{(((,...))))),))))}})})))))),.,})}}))}|||,,(((((.(((((((..({((...(((.....)))))).)..))))))).)))))..,,.....}}))))))||)}.|}.)})}})),)))))},.{((.....))}.........,....,.....,,,,.....||||((,,(((,{{,....{(({|{|,.,,|))))))),,,,||||{,|,{,.....(((((((..(((((((...)))))))..))).))))...|,{.,,|}}.},||{{||({{(,((({(,,..|,{|||{{||{||}||||||{,|||}|}}}.{{{.{||||{{.((......}}..........|{||,|||,,,,,,||.....,.,|||||}}.}))||||{{{.......},((((((((....))).)))))})|||,,||},,,})),,}))},,.,,|)))))|}}.))}))).},,.))))))))},}))))}},.|}||....,},..}))}}},.}}|,,.,,},|{.,{.....))).)))..}}}}}}..(((...(((({...}))))...)))}))}.)).......

Transcripts

ID Sequence Length GC content
GUUAACAGGCGCGUCCCGGCCAGGCGGAGACGCGGCCGCGGCCAUGGGC… 5578 nt 0.5929
AAUCCAUCAUGGCGGCCGCGGGGUUUGGUGUCUGUGCCUGAGCAGCGCU… 6719 nt 0.5766
Summary

This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014] CIViC Summary for ABL1 Gene ABL1 is most relevant to cancer in its role in the BCR-ABL fusion protein that has become a signature of chronic myeloid leukemia (CML). Cells harboring this fusion have shown sensitivity to imatinib, greatly improving the prognostic outlook of the disease. However, additional mutations in ABL1 have been shown to confer resistance to imatinib. In these resistance cases, second-generation tyrosine kinase inhibitors such as dasatinib and nilotinib have exhibited some efficacy and are currently undergoing clinical trials for treating acquired resistance in CML.

Forensic Context

No relevant information is available at the moment.