Basic Information

Symbol
MSX1
RNA class
mRNA
Alias
Msh Homeobox 1 HYD1 HOX7 Msh Homeobox 1-Like Protein Homeobox Protein MSX-1 Homeobox Protein Hox-7 OFC5 Msh (Drosophila) Homeo Box Homolog 1 (Formerly Homeo Box 7) Msh Homeobox Homolog 1 (Drosophila) Msh Homeobox Homolog 1 Msh Homeo Box 1 Homeobox 7 STHAG1 ECTD3
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_002448.3
Sequence length
1940.0 nt
GC content
0.5985

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-825.90 kcal/mol
Thermodynamic ensemble
Free energy: -862.22 kcal/mol
Frequency: 0.0000
Diversity: 496.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((((((.....).))))).((((((((((((((((((((((.......((((((.((((((((((.((((.(.((((((..((.(((((((((((((.((((((..((.(.(((((((((.(((..((((.(((((((...((.(((((.....)).)))...)).))))))).))))..))).)))...((((((((((((((((.((((((((.((((((((((.(.((((((((((((((((........(((((.(((...))).))))).(((((......)))))((((.(..(((((((((.(((((((((..(((((((..(..(((((((.(((.(((....))).))).))))).)).)..)))))))..))))...))))))))))))))).))))..)))))((((.(((.......)))..))))....)))).))))))).).)))))(((...(((((((...)))))))...)))((((((..((((((........))))))..))))))(((.((.....)).))))))..)).))))))))))))))).)))).)))))..(((((((..((((.(((.((..(((....((........)).....))).))))))))).....).))))))))))))).))..)))...)))))))))))))))))).))))))).)))))))).).......)))))...))))))............((((((((.((.((((.............)))))).(((.(((((...(((((....)))))))))).)))..(((((((...((((.(((((.(((((....))).)).))))).))......))...)))))))....)))))))).....)))))))))....................))))))))..(((((.(((((((.((((((...(((....))).....)))))).))))))).))))))))))..((((((((((.((((.((..((((((...(((((((((..((....((((((..((((......)))).))))))....))....)))))))))((((((((....(((((....))))).....((((........))))..)))))))).)))))).)).))))))))).)))))...........(((((((((......((((.((((.(((((((((((.......))))......((((((((.((...(((((((((((((.(((((((((((...((((.((((......((........)).......))))(((((((((((........)))))))))))............))))..))).)))))).)).))))))).)))))).)))))))).)).............((((((((((.((....(((((((...(((((........((((((((...(((((((..((.((((....)))))).))))))))))).(((((((........))))))).....(((((....)))))........................................)))).........)))))...(((((((((.(........).))))))..)))..............)))))))....))...)))))..))))))))))))..(((((....))))).....)))).))))((((((....))))))..)))))))))..((((((.((((...(((((.....................)))))...)))).)))))))))))).....(((((((...))))))).((((((........)))))).(((((..(((.(......).)))..)))))..(((((......(((((.....)))))....)))))......
Thermodynamic Ensemble Prediction
,({{(((((((((.....}.)))}}}))}..{{{((((((((((((((..,.,..((((((.(((((,((((.((((.(.((((((..((.(((((((((((((.((({({{((({(.((({(((((.(((..((((.(((((((...((.(((((.....)).)))...)).))))))).))))..))).))))}|((((((((((((((((.((((((((.(((({(((((.(.((((((((((((((((....,,..{{{((,({{..,))).)}))),(((((......)))))((((.(..(((((((((.(((((((((..(((((((..(..(((((((.(((.(((....))).))).))))).)).)..)))))))..))))...)))))))))))))).,))))..)))))((((.(((.,....,)))..))))....)))))))))))).).)))))(({,{{{((((({...})))))}.}}))|((((((,,((((((....,,}.)))))),.))))))(((,((.....)).))))))..)).)))))))))))))))||))).)))),.{(((((((,,((({.{{||||..(((....,..,..,,,|||.,,..}}}.))))))))),,,,,),)))))})),})))})),.))).,.)))))))))))))))))).))))))).)))))))).}.......)))))...)))))),...........((((((((.(,{((((..,.......,..))))}|.(((,(((((,..(((((....)))))))))}.}))..{({{(((...,,((.(((((.(((((....})).)).))))).)).....,))}..)))))))....}))))))).....)))))))))..}))),..}}}......,((((..(({..(((((.(((((((.{(((((...(((....))).....)))))}.))))))).))))),})))))|(((((({{{{((((.{{..((((((|.|{(((({((|.|((,...|((|({|.||||},},..))))})))))),}}})),{{{|||}|||||((({(({,....|||||}}}.)))))}}}}.,,({,{{..{{,.,.,.|}})))}}}.)))))).}).))))))))).)))),..,},,.{{,,(((((((((......{{{{,{(({.{{{{((||(((.......)))|||{{,,{{(((((((((...(((((((((((((.(((((((((((...((((,{,..,...,.|{|,,{{............||||(((((((((((......}.))))))))))),,},.}},,...))))..)))},))))).)).))))))).)))))).)))))))).{{,....,,,.,}}|((((((((((.{(,...(((((((...{,((((.(({,..((({((((...(((((((..((.((((....)))))).)))))))))))}||,||,|}}.}}},.},,||||.....(((((....))))).....................................................,,.,||{{{.,((((((.{........).)))))).,)))..............)))))))..,,},...)))))}.,))))))))))),.(((((....))))).....)))),)))){(((({....))))))..)))))))))..((((((.((((...(((((...,,,.........})}...)))))...)))).)))))))))),,...{{(((((((...))))))}.||(((({,...,,.,})))),((({{,,((({({,,,,{|.}||..||||,..,{{,|}}}..}|,|||,}}},..}))}})}))}))},....

Transcripts

ID Sequence Length GC content
AGGGCCCGGAGCCGGCGAGUGCUCCCGGGAACUCUGCCUGCGCGGCGGC… 1940 nt 0.5985
Summary

This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the mRNA marker MSX1, part of the MB triplex for menstrual blood identification, was detected in dried stains but exhibited lower sensitivity compared to MMP markers and tended to disappear towards the end of menstruation [Haas et al. DOI:10.1016/j.fsigen.2013.09.009]. In a separate probabilistic evaluation using human body fluid datasets, the MSX1 provided marker values and amplification rates, contributing to classification models that correctly identified cell types in approximately 87% to 94% of samples when using naïve Bayes or multinomial logistic regression methods [de Zoete et al. DOI:10.1016/j.fsigen.2015.09.007].