| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGCCCGGAGCCGGCGAGUGCUCCCGGGAACUCUGCCUGCGCGGCGGC… | 1940 nt | 0.5985 |
This gene encodes a member of the muscle segment homeobox gene family. The encoded protein functions as a transcriptional repressor during embryogenesis through interactions with components of the core transcription complex and other homeoproteins. It may also have roles in limb-pattern formation, craniofacial development, particularly odontogenesis, and tumor growth inhibition. Mutations in this gene, which was once known as homeobox 7, have been associated with nonsyndromic cleft lip with or without cleft palate 5, Witkop syndrome, Wolf-Hirschom syndrome, and autosomoal dominant hypodontia. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the mRNA marker MSX1, part of the MB triplex for menstrual blood identification, was detected in dried stains but exhibited lower sensitivity compared to MMP markers and tended to disappear towards the end of menstruation [Haas et al. DOI:10.1016/j.fsigen.2013.09.009]. In a separate probabilistic evaluation using human body fluid datasets, the MSX1 provided marker values and amplification rates, contributing to classification models that correctly identified cell types in approximately 87% to 94% of samples when using naïve Bayes or multinomial logistic regression methods [de Zoete et al. DOI:10.1016/j.fsigen.2015.09.007].