Basic Information

Symbol
MT1A
RNA class
mRNA
Alias
Metallothionein 1A MT1S Metallothionein 1S Metallothionein-1A Metallothionein-IA MT-1A MT-IA MT1 Metallothionein 1A (Functional) MTC
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005946.3
Sequence length
396.0 nt
GC content
0.5051

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-108.90 kcal/mol
Thermodynamic ensemble
Free energy: -117.77 kcal/mol
Frequency: 0.0000
Diversity: 104.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((.......(((((..((((....(((...((((..((..(((...(((...........((.((......)).)).....((.((((.((((((((((((((.((((..((((........))))..)))).((.((((....))))))...(((..(.((((....)))).)..))).....)))))..))).)))).)).))))))(((....)))...(((((((((....((((((...))))))))))))))))))...))).))..))))....)))....))))..))))).....(((((......))))).............(((((((.(((((((.......))))))))))))))............))).......
Thermodynamic Ensemble Prediction
....{({.......((((({......}}.......((((((((,{(((...,|||....{{{{{.(({.{{...,{||.|}},...|{,,,,)}}||.,.}}})|{...{(({..((((.,.||...|||,..}))).,{|{(((....)))},)}..))))))))((((((.{((((((.((((((.{,,({{((((,.,{{.,,..,.,}))}))),,,}),..)))))).))).),,}}))))))(((((.((.,....,.)))))))..,((((.............))))}....)))).....(((((......))))).............(((((((.(((((((.......)))))))))))))).......,,}},)}},......

Transcripts

ID Sequence Length GC content
ACCAAGCCUUCCACGUGCGCCUUAUAGCCUCUCAACUUCUUGCUUGGGA… 396 nt 0.5051
Summary

This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions. The conserved cysteine residues co-ordinate metal ions using mercaptide linkages. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. Disruption of two metallothionein genes in mouse resulted in defects in protection against heavy metals, oxidative stress, immune reactions, carcinogens, and displayed obesity. [provided by RefSeq, Sep 2017]

Forensic Context

A study in human HT-29 colorectal adenocarcinoma cells demonstrated that arsenic trioxide exposure induced a 11.69-fold upregulation of the MT1A gene, with its expression maintaining a maximum at low doses (5 µM) [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In mice, radiation exposure from α-particles and γ-rays commonly up-regulated Metallothionein 1, a characteristic response compared to chemical hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].