| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCAAGCCUUCCACGUGCGCCUUAUAGCCUCUCAACUUCUUGCUUGGGA… | 396 nt | 0.5051 |
This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions. The conserved cysteine residues co-ordinate metal ions using mercaptide linkages. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. Disruption of two metallothionein genes in mouse resulted in defects in protection against heavy metals, oxidative stress, immune reactions, carcinogens, and displayed obesity. [provided by RefSeq, Sep 2017]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that arsenic trioxide exposure induced a 11.69-fold upregulation of the MT1A gene, with its expression maintaining a maximum at low doses (5 µM) [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In mice, radiation exposure from α-particles and γ-rays commonly up-regulated Metallothionein 1, a characteristic response compared to chemical hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].