| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCACACCUUCCUCCUGCCCUGACUUCUCAUAUCUUGCCUAGGAACUCC… | 393 nt | 0.5038 |
The protein encoded by this gene binds heavy metals and protects against toxicity from heavy metal ions. This gene is found in a cluster of similar genes on chromosome 16. [provided by RefSeq, Jul 2016]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1B was induced 17.39-fold by arsenic trioxide exposure, with dose-dependent upregulation confirmed by qRT-PCR [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. The research systematically evaluated cellular responses to heavy metals, revealing that the expression of the MT1B and other metallothionein genes was regulated in a metal-specific manner, providing a new perspective for metal toxicity assessment. A study in mice demonstrated that the MT1B was commonly up-regulated more than 2-fold in liver tissue after in vivo irradiation of Kupffer and endothelial cells with α-particles, a characteristic response to radiation exposure compared to hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].