Basic Information

Symbol
MT1B
RNA class
mRNA
Alias
Metallothionein 1B MT1Q Metallothionein 1Q Metallothionein-1B Metallothionein-IB MT-1B MT-IB MT1 Metallothionein 1B (Functional) MTP
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_005947.3
Sequence length
393.0 nt
GC content
0.5038

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-108.80 kcal/mol
Thermodynamic ensemble
Free energy: -115.23 kcal/mol
Frequency: 0.0000
Diversity: 113.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....................((.(((.((((((.(((..((((((.(((((((((((.((((.(((....)))..)))).(((....))).((((((.....))))))..(((((..((....))..))))).((.((((....))))))...))))).(((((((.((((((....((((..(((((............)))))))))((((((((((.((((.((.(((.(......).))).)).))))..))).(((((.......))))))))))))...))))))..)))))))..))))))...............(((......)))..............))))))..))).))))))))).))....................
Thermodynamic Ensemble Prediction
.,{,,...........{,..,{,{{{.{(,,,,.,,({{(,((,..,||||||,,|,.{(((.(((....)))..)}},.(((....))).((((((.....))))))..(((((..((....))..))))).,({((((....)))},)}..|||||,{({{{{{.,|||||}||.((((..{((((...,,...,...))))))))){{{((({,,,.||||.{{.{{{,|,,,,..}.)||,|},}}}}.{||{{(((((.......)))))))))))...,)})))).,|||}}},..})))),...............{{{......)))..,...........,,}}}}..,,,.,)))))|||.||,..........,}}..,,..

Transcripts

ID Sequence Length GC content
AUCACACCUUCCUCCUGCCCUGACUUCUCAUAUCUUGCCUAGGAACUCC… 393 nt 0.5038
Summary

The protein encoded by this gene binds heavy metals and protects against toxicity from heavy metal ions. This gene is found in a cluster of similar genes on chromosome 16. [provided by RefSeq, Jul 2016]

Forensic Context

A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1B was induced 17.39-fold by arsenic trioxide exposure, with dose-dependent upregulation confirmed by qRT-PCR [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. The research systematically evaluated cellular responses to heavy metals, revealing that the expression of the MT1B and other metallothionein genes was regulated in a metal-specific manner, providing a new perspective for metal toxicity assessment. A study in mice demonstrated that the MT1B was commonly up-regulated more than 2-fold in liver tissue after in vivo irradiation of Kupffer and endothelial cells with α-particles, a characteristic response to radiation exposure compared to hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].