| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUGCUUUCCAACUGCCUGACUGCUUGUUCGUCUCACUGGUGUGAGC… | 746 nt | 0.5322 | |
| AUUCUGCUUUCCAACUGCCUGACUGCUUGUUCGUCUCACUGGUGUGAGC… | 398 nt | 0.5000 |
Predicted to enable zinc ion binding activity. Involved in cellular response to cadmium ion and cellular response to zinc ion. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1E was induced 6.62-fold by arsenic trioxide exposure, with its expression peaking at 5 µM, and also showed a peak in expression at 10 µM cadmium chloride, indicating metal-specific regulation [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. Furthermore, a meta-analysis of human lung scRNA-seq data identified the MT1E as a top up-regulated differentially expressed gene in a specific monocyte subcluster from COPD patients, associating it with responses to heavy metal cations [Lee et al. DOI:10.1016/j.compbiomed.2023.107685]. A study in mice demonstrated that the MT1E was commonly up-regulated more than 2-fold in liver tissue after in vivo α-particle and γ-ray irradiation, a characteristic response distinguishing radiation exposure from chemical hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].