| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCACGCCCUCCACGUGUUCCACUGCCUCUUCUCUUCUCGCUUGGGAAC… | 397 nt | 0.5214 |
Predicted to enable zinc ion binding activity. Involved in cellular response to cadmium ion and cellular response to zinc ion. Predicted to be active in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1H was induced 80.9-fold by arsenic trioxide exposure, with dose-dependent upregulation confirmed by qRT-PCR [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In mice, radiation exposure from α-particles and γ-rays commonly up-regulated Metallothionein 1 genes in liver tissue, a characteristic response compared to chemical hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].