Basic Information

Symbol
MT1M
RNA class
mRNA
Alias
Metallothionein 1M MT1K Metallothionein 1K Metallothionein-1M MT-1M MT-IM MT1 Metallothionein 1Y Metallothionein-IM
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_176870.3
Sequence length
398.0 nt
GC content
0.5201

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-120.70 kcal/mol
Thermodynamic ensemble
Free energy: -128.57 kcal/mol
Frequency: 0.0000
Diversity: 84.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.((....))))))((..(((((..((((....(((((.((((((..(((((.......((((((......((((.(((..(((....)))....))).))))..(((((.((((........)))).))))).((.((((....)))))).(((..(((((((((((..((((.((..((((((((((............)))))))((.......))...)))..)).))))....))))))(((((.(((.....))).))))).)))))..))).((((.....)))))))))).....))))).....))))))..)))))..))))...))))))).......((((..(((((..(((.............)))..)))))..))))
Thermodynamic Ensemble Prediction
.((((.((....))))))|,..((((({.((((....(((((.((((((..(((((.......((((((......((({.{{{..(((....)))....})),))}}..{((({.((((,..,,...,))}.)))))..(,((((....))))}),(((..(((((((((((..((((.((..{{((((((((...,,...,,,.)))))))),.,,,{{{,,...}))}})).))))....)))))}(((((.(((.....))).))))),)))))..))).((((.....)))})))))).....))))).....))))))..)))))..)))).,.}}))))}.......,{((,,(,,,,.,|||}}|,.,..,,...,,,..},},}..},..

Transcripts

ID Sequence Length GC content
ACCACGCCGUCCGGGUGGGCCUAGCAGUCGCUCCAUUUAUCGCUUGAGA… 398 nt 0.5201
Summary

This gene encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids. [provided by RefSeq, Oct 2011]

Forensic Context

A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1M was induced 24.67-fold by arsenic trioxide exposure and its expression specifically peaked at 10 µM cadmium chloride, showing metal-specific regulation as part of the cellular defense against heavy metal toxicity [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. Furthermore, a meta-analysis of human lung scRNA-seq data identified the MT1M as a top up-regulated gene in a specific monocyte subcluster from COPD patients, associating it with responses to heavy metal cations [Lee et al. DOI:10.1016/j.compbiomed.2023.107685]. A study in mice demonstrated that internal exposure to α-particles, specifically targeting Kupffer and endothelial cells in the liver, induced a characteristic inflammatory state and altered gene expression profiles [Roudkenar et al. DOI:10.1269/jrr.07078].