| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCACGCCGUCCGGGUGGGCCUAGCAGUCGCUCCAUUUAUCGCUUGAGA… | 398 nt | 0.5201 |
This gene encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids. [provided by RefSeq, Oct 2011]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1M was induced 24.67-fold by arsenic trioxide exposure and its expression specifically peaked at 10 µM cadmium chloride, showing metal-specific regulation as part of the cellular defense against heavy metal toxicity [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. Furthermore, a meta-analysis of human lung scRNA-seq data identified the MT1M as a top up-regulated gene in a specific monocyte subcluster from COPD patients, associating it with responses to heavy metal cations [Lee et al. DOI:10.1016/j.compbiomed.2023.107685]. A study in mice demonstrated that internal exposure to α-particles, specifically targeting Kupffer and endothelial cells in the liver, induced a characteristic inflammatory state and altered gene expression profiles [Roudkenar et al. DOI:10.1269/jrr.07078].