| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCACGCUUUUCAUCUGUCCCGCUGCGUGUUUUCCUCUUGAUCGGGAAC… | 404 nt | 0.4926 |
Predicted to enable copper ion binding activity and zinc ion binding activity. Involved in cellular response to cadmium ion; cellular response to erythropoietin; and cellular response to zinc ion. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1X was induced 74.13-fold by arsenic trioxide exposure, with expression peaking at low doses (5 µM) [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In a separate meta-analysis of human lung tissue from COPD patients, the MT1X was identified as a top up-regulated differentially expressed gene in a specific monocyte subcluster, associating it with responses to heavy metal cations [Lee et al. DOI:10.1016/j.compbiomed.2023.107685]. A study in mice demonstrated that the MT1X was commonly up-regulated more than 2-fold in liver tissue after in vivo exposure to α-particles or γ-rays, a characteristic response to radiation compared to hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].