Basic Information

Symbol
MT1X
RNA class
mRNA
Alias
Metallothionein 1X MT-1l Metallothionein-1X Metallothionein-IX MT-1X MT-IX MT1 Testicular Tissue Protein Li 124
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005952.4
Sequence length
404.0 nt
GC content
0.4926

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-110.10 kcal/mol
Thermodynamic ensemble
Free energy: -117.38 kcal/mol
Frequency: 0.0000
Diversity: 86.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.................)))))......(((.(((((((....))))......(((((........(((..(((((.((........))..))))).))).((((...(((..((((.(((....)))..)))))))...)))).....)))))..((((....)))).(((.(((((..((((............))))))))).)))...(((((.((..(((((....((((((..(((((.((((....)))))))))..((((((...........)))))).((...........))...................))))))....))))))).))))).((((.((((.......)))).))))((((........))))))).)))...
Thermodynamic Ensemble Prediction
..(((((.................)))))......{{,.({.,(((|,..,,,}..,,..,((((,.......(((..(((((.((........))..))))).})).{,((|..,||.}||,,.,||...,|||..||{{||....)))),)}.})))}}..((((....)))).(((.(((({,.((((........,,..))))))))).)))...(((((.((..(((((....((((((,.(((((.((((....))))))))).}{(((((.,........})))))}.,{..........,))...................,)))))....))))))).))))),((((.,(((,......)))).))))},,,})}},.....,,,,,.,},...

Transcripts

ID Sequence Length GC content
ACCACGCUUUUCAUCUGUCCCGCUGCGUGUUUUCCUCUUGAUCGGGAAC… 404 nt 0.4926
Summary

Predicted to enable copper ion binding activity and zinc ion binding activity. Involved in cellular response to cadmium ion; cellular response to erythropoietin; and cellular response to zinc ion. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT1X was induced 74.13-fold by arsenic trioxide exposure, with expression peaking at low doses (5 µM) [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In a separate meta-analysis of human lung tissue from COPD patients, the MT1X was identified as a top up-regulated differentially expressed gene in a specific monocyte subcluster, associating it with responses to heavy metal cations [Lee et al. DOI:10.1016/j.compbiomed.2023.107685]. A study in mice demonstrated that the MT1X was commonly up-regulated more than 2-fold in liver tissue after in vivo exposure to α-particles or γ-rays, a characteristic response to radiation compared to hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078].