| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCACGCCUCCUCCAAGUCCCAGCGAACCCGCGUGCAACCUGUCCCGAC… | 401 nt | 0.5561 |
This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions, altering the intracellular concentration of heavy metals in the cell. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. The encoded protein interacts with the protein encoded by the homeobox containing 1 gene in some cell types, controlling intracellular zinc levels, affecting apoptotic and autophagy pathways. Some polymorphisms in this gene are associated with an increased risk of cancer. [provided by RefSeq, Sep 2017]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that the MT2A was induced 22.88-fold by arsenic trioxide exposure, with dose-dependent upregulation confirmed by qRT-PCR [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In a separate meta-analysis of human lung tissue from COPD patients, the MT2A was identified as a top up-regulated differentially expressed gene in a specific monocyte subcluster, encoding a protein involved in metal ion detoxification and homeostasis [Lee et al. DOI:10.1016/j.compbiomed.2023.107685]. A study in mice demonstrated that the MT2A was commonly up-regulated following Kupffer cell-specific and endothelial cell-specific in vivo exposures to α-particles, as identified through oligonucleotide microarray analysis and validated by real-time PCR [Roudkenar et al. DOI:10.1269/jrr.07078]. This up-regulation was part of a broader inflammatory state and characteristic gene expression profile induced by radiation exposure in liver tissue.