| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGCCGCGCGUCCAGUUGCUUGGAGAAGCCCGUUCACCGCCUCCAGCUG… | 406 nt | 0.6059 |
This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions. This gene family member displays tissue-specific expression, and contains a threonine insert near its N-terminus and a glutamate-rich hexapeptide insert near its C-terminus relative to the proteins encoded by other gene family members. It plays an important role in zinc and copper homeostasis, and is induced under hypoxic conditions. The encoded protein is a growth inhibitory factor, and reduced levels of the protein are observed in the brains of individuals with some metal-linked neurodegenerative disorders such as Alzheimer's disease. [provided by RefSeq, Sep 2017]
A study in human neuroblastoma (SH-SY5Y) cells demonstrated that manganese exposure induced a 3.36-fold upregulation of the MT3 mRNA, and this induction was dramatically potentiated to 500-fold by the hypoxia mimetic deferoxamine and up to 30-fold by zinc [Cahill et al. DOI:10.3390/Biom14060647]. A study in mice demonstrated that the MT3 was commonly up-regulated in liver tissue following specific in vivo irradiation of Kupffer and endothelial cells with α-particles, a pattern characteristic of radiation exposure compared to hepatotoxicants [Roudkenar et al. DOI:10.1269/jrr.07078]. In human colorectal adenocarcinoma cells, systematic evaluation of heavy metal exposure revealed that the MT3 gene was induced in a metal-specific manner, with arsenic trioxide causing significant upregulation [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774].