Basic Information

Symbol
MTF1
RNA class
mRNA
Alias
Metal Regulatory Transcription Factor 1 MRE-Binding Transcription Factor Transcription Factor MTF-1 Metal-Responsive Transcription Factor 1 MRE-Binding Transcription Factor-1 Zinc Regulatory Factor MTF-1 ZRF
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_005955.3
Sequence length
7937.0 nt
GC content
0.4660

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2538.80 kcal/mol
Thermodynamic ensemble
Free energy: -2683.52 kcal/mol
Frequency: 0.0000
Diversity: 1838.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((.(((((.(((.((((((((....(((((((.....((((((.(((((((.((((((((((((((((((((((.(((.(((.....(((((((.........(((.((((....((((.............((((((.(((((...)))))..))))))))))..)))).)))......)))))))((((((........)))))).((((((((((......))))(((((((....(((((....)))))...)))))))......))))))))))))))))))))))....((((((.(((((((..(((((.(((........))))))))..(((((.((.(((((((((..((.((..(((.(((.(((((((((((((...))))).((((....))))((((....))))......))))))))....)))....))))).))..))))..))))).))))))).))))))).)......)))))........(((.((((((((...((((((...(((((((..((((((((((((((((((...(((((..(((((...))))).....(((((.((((((((.((((((.(((.......(((((((....(((((((((.......)))))))))..(((((((((((((...........((((.((((((.((((((.....)).)))).)))).)).)))))))))))))).)))..........((((((.((((((((......(((((.......(((((..(((...)))..)))))..))))).((((((.((((((.(((..((((.(((((....)))))(((.....)))...(((.....)))....(((((((...(((....))))))))))))))..))).)))))).)).))))............((((((.((((.....((((((.(..(((.......)))..))))))))))).))))))......)))))).))...))))))...........(((((....)))))........(((....(((...)))....))).........((((.((((((...(((.(((((...........))))).)))...))))))))))....((((((((((((((.....(((.((.(......).))..))).))).((............)).(((((((..((((...((...))..)))))))))))...))))))))))).........))))))))))))))))..)))..)))))..)))))((((((((((..((((.((...((((((((((........(((((.(((((((((...(((((..((.((....(((((.((((((((.(.(((.((((((........(((.((((.(((.(((((((((...((((((.((.(((((((((((((.((((((((((((...(((((...(((.((((((((((.........(((((((...(((.....((((((...((..(.(((((.....((((((.(((((..........(((.(.((((((((...((..(((((.((((..((((((((((((((..(((((...(.((((((.(((..(((.(((.((..(((((((...(((.(((.((((((..((((((((.((((((((((((........((((((((((.(((((...(((((((.............................((((.(((((((((....((((((.(((((....(((..((......))..))).....)))))......((((...))))....((((((((.(((((.(((....(((((((((...(((((.((.(.((((.....))))..((((((....((((((((((((...(((.(((((((...)))))...))))).(((((((((.(((.............((((((((((....)))).(((.(((..((.((((..(((((...(.((((((..(((.((((((...(((((((((................))))..))))).....)))))).))))))).)))))))).)))).))))).)))..))))))(((..(((.....((.(((((.((((.........(((((((((((..((...))..))..((((((....(((((((..(((.((((.(..(((........)))..).)))).)))..))).......((((...(((((.....))))).)))).........))))..)).)))))))))))))))))))))).))....)))..)))....(((((....((((((((..(((((((((((......)).)))))))))((((((((........)))))).))..))))))))....)))))..(((((((((((..(((.((((((((........))))))))))).)))))))))))..))).)))))))))...((((((((((...))))))))))................................))))((((.......))))..))))))))))))))).))))))))))))))))...)))...))))).(((....)))((((..(((((......(((.....)))((((((.(((...(((((...)))))..))))))).)))))))..)))).))))))))....))))))........))))))))).))))..((((((...(((((................)))))......))))))...........(((.....))))))))))))))...).)))).).)))))))))).))))).))))))))))((((.(......).))))..)))))).))).)))))))))))).))).)))..)))..))))))))))))...))))))))).......)))))..)))))))))..))..))))))))).)))...(((...(((.(((((((.(((((((........(((...((((..((((.((((((((((((((((((((.(((((..((((.........(((.....)))..........)))).))))).))))))))).(((.(((((((..(((((...)))))..)))))))...)))((((((.(.......(((..((.(((((......))))).))..)))(((((((.(((.(((((((((((....((((((((........))))))))....)))))))))))..))).))))))).......(((((((.........(((((.(((((.(.(((((((.........))))))))))))).)))))....)))))))......)))))))..)))))))))).).)))))))).)))..(((((((..((((((((((((...((..((((.(((.(((............))).))).))))..))((......)).....((((....................))))...............(((((((((.(((.............))).)))))))))...(((((.(((...(((...((((.((((.......)))).))))...)))...((((((((((((((((((((..((((..((((.......))))..)))).(((......)))....(((......))).((((((......))))))..(((.(.((((((..(((...)))((((..(((((....)))))))))(((((((..(((.((((........)))).))).(((((((.....)))))))((((....))))......(((((((.((((..(((..........)))))))))))))).......(((...))).......(((((.......))))))))))))))))))).)))(((((((((((((....)))))((.....))...........)))))))).........)))))))))))))))..((((((((((....)))).....)))))).)))))..((((((.((.(((((.....((.((((((((((........)))))))))).))......)))))..)).))).....))).((((((((((((((((((((........))))........(((((.((((((..((((..((....(((((.((((((((.(((((.((....)))).))).)))..)))))....)))))..)))))))))))).)))))..(((((......)))))....(((((((.((...(((((((((((((..........))))).(((.(((((..((.(((((((((..((..((....))..)).)))))))..)).))..).)))).)))....(((((......)))))...)))))))).))...))))))))).))))))....((((.......((((((((((....((((......)))).((((((((((((((((.........)))))))))))).)))).))))))))))...)))).))))))))))))))))))))))))..))))))))))))))))))..)))))))))).))).))))).))))))))))).)..))))))))..))))))))))))))))))).)..)))...)))))...)))))).....(((((((....)).)))))(((((.........)))))....)))))).))))))..))))))).)).))))))....))))))....))).)))...)))).)))..(((.((((((...((....((((..((((((((.(((..(.(((((...))))).)..))).)))...)))))...((((((((.......)))))))).))))..))...)))))).)))...))))))...((((.((((((.((((((((..(((((.(((((((((.(((.....))).....(((.(((((((((.(((.(((........((((((....)))))).((((((.....((((((.(((.((....((((((...((((((((....)))))))).))))))....))))).....((((((.(((((..(((((..(((((((((((.((((((((((.((((.(((.((((((((((((..(((...)))..)).((..(((((.((((..(((...((.((((((.(((((((((((....))))))......(((.((.((((..(((((((.((((.......((....)).......)))))))))))..)))))).)))........))))).)))))).))...)))...)))).)))))..))....))))))...................)))).))).)))).)))))))))).)).)))))...))))))))).))))))))))))))))).((((((((((((((.((((..((((((...(((.(.(((..((((((((((((.......))).)))))).)))..))).).)))...))))))..)))).)))))......)))))))))......((((..(((.....)))...))))((((........)))).....))))))..((((.....)))).....))).))))).)))))))..))))))))).))).))))).))))))))...)))))).))))))).).))))))))........)))))....)))).)))))..))))))))).))))))))).))))))...))))))..))))))))))..)))))...))))...).))))).)))........)))))....)))))))((((((...(((((..((((.......))))..)))))...)))))).......)))))).)))))))))))(((((((((....)))))))))(((((((..(((((.((((((((.......)))))))).)))))...))).))))......(((((......))))).............)))))).).)))))))..))))))))))).))))))))))))))).)))..)))))...))))))))).........((((.((((((((((((((((((((((...((((.((.(((..(..(((((.....(.(((((....)))))).....)))))..)...)))..))..))))...))).....(((.(((((..((((((((((((..........((((.....))))....(((((((((..((..((.(((((.((((..((..((((((((((...)))))))((((....))))((((.....((((((((((((((((((.(((((..((.((...((((..(((((...)))))..))))...)).))...)))))...))))..))))).....)))))))))....)))).......(((((((((((((((((((((((((((((((((((..(((((((..(((.........)))..)))))))....))))))))))...))))))))))...(((((.....)))))...........................................................((((((((((......................((((..((.(((..(........)..))).))..))))..(((((((..((((.((((.......)))).))))..)))))))........((.((((.....)))).))..........))))))))))((..((....))..)))))))))))))))))..((((...)))).....)))))..))))))))).))))..)))))))))((((....(((........(((((((..(((............)))..))))))).........)))..))))...)))))))))))).))))).))).(.(((((((((((((......(((......)))....(((((...)))))..(((((((...((....(((((((.......(((((((((.....))))))))).((((((..((.......((((((((......)))))))).....((.....)).((((((((((....(((((((((...)))))))))........((((((((.(((((((((((((......)))))))))((((......(((((((....((((((((((((((((((((..((((((.(((......))).((((((.(((((((...(((((.....(((((((.(((((........))))).))))))).....)))))(((((((((((...............))).))))))))...))).)))).....))))))..(((((((...((((((..(((........)))..)))))))))))))))))))))))))))......))))))......)))))).))))))).....))))..)))).)))))).))(((((((.(((((.(((((....))))))))))...)))))))))))).)))))...))..))))))......(((((((..(((((.....))))).))))))).(((((...))))))))))))....)).)))))))..........))))))))))))).))))))))...)))))))))))).)))).....(((((..((((....((((((((((..(((((........(((((((((.........)))))))))..)))))...)))))))))))))).)))))........((((((....)))))).
Thermodynamic Ensemble Prediction
..(((((((((.(((((.(((.((((((((....(((((((.....((((((.(((((((.((((((((((({(((((((({{((((.(({.....(((((((.........(((,((((....((((.............((((((.(((((...)))))..)))))))))).})))).)))......)))))))((((((........)))))).((((((,(((......}}},(((({,..,}}||{,|,.{{{{||,...,))))))...,..))))))})))))))))))))))....((((((.(((((((..(((({.(((........)))}))))..(((((.({.(((((((((..((.((..(({.{({.(((((((({((((,,.}}}}}.{{((....,}}|,{||....,)))},,...))))))))....}}}....))))).))..))))..))))).})))))).))))))).},....,)))))....,...{{{.{{((((((...(((((({,,(((({{{,,(({(((((((((({((((...(((({..(((((...))))).....(((((.((((((((.(((((({{((.......(((((((....(((((((((.......)))))))))..{{(((((((((((...........((((.(({((({({{(((.,...}}.)))|.))))})).)))}))))))))))}|}}..........{(((((.((((((({.{,.,.{{{{{,,,|||.(((((..((,...}))..)))))..}}}}}.((((((.((((((.(((..((((.(((((....)))))(((.....)))...(((.....})),...(((((({,,{{{,....),))))))))))))..))).)))))).)),,)))............((((((.((((.....((((((.(..(((.......)))..})))))))))).))))))......}))))).))...)))))).,.....{{..(((((....)))))....,...{|{....{,,...,}}....|||,........||||.{{((((,{.{{,.((({({{{,,.....,))))).})),..}}||||}}},,,},((((((((((({{{.....{{{.{..,......||,,..}},.}}}.({............}}.((((((,.,((((,...,....,}.}))))))))))...))))))))))}.,,,,,},.))))))))))))))))..)),.,)))))..)))))((((((((((..((((.((...((((((((((........(((((.(((((((((...(((((..({.{(....(((((.((((((((.{,({(.((((((,,{{....(((.((((.(((.(((((((((...((((((.((.(((((((((((((.((((((((((((,,.(((((...(((.{(((((((((.........(((((((({((({.....}||||,{{{{{,,||}||{{,.......{(({,.|||,..,,,....,,|||.,,,,,||}...|||...|}}},,,,(((((((((((({.((....)).}))))))))))))))))).,}))))))|(((((...((((.(((.((((,.,,,.,.(((.....((((....))))..,}.)))..{((,(((((((.....,{({.....{,,.(((((((((,...(((((((((..,,((((((,{{{,(((,,.(((({{(,{|,..,{{{..{(||||,,|,..,||.....|||.,......{(({,,.}}}}|||||,,.,,......|||||,..{(((((...........))))),..{(({.....}}}}||||}}},..,,}},||{{,|.|{,,.||({(((((((((((({{((.,((((((,{({{(,{{(({,...,}}},.....{{{{{((((({,,{}}},.{{|,{||,,||,((((,.((((,.,((,((((((..(((.((((((...((({{((((,,..............)))}.,}))}),....)))))).})))))).|}||||}|,}}}}.))))),}}}..}}}}}}.((((,,,.....||}|......,{,,..{{{(((((((((,,((,(((({{.(({..{{{(((((,.,.,{{(((({.,{(({(({({(.{(({..,{,,,.,,{({|{||{|{{{|,{{{{..,,,,,({{{...(((((.....))))).)))).,,{{|.,||.,||,,..,}})})})))}||||}||||{{|,|,,.|,,,..,|||}},|,,||,...((((((((,.(((((((((((......)).)))))))))({((((((........)))))).))..)))))))),,,.})))),.(((((((((((..(((.((((((((........))))))))))).)))))))))))}}}}}}.{({({{{{{{,{(((((((({...}))))))))}.....................,,,,......((((((({{.......,,}}..,))))){|||||,,....{||||||||||,,},{,,({({,((({{...}}})),))}).|},|{.(({{{{.{((({{..{|.{{(((((.(((...(((({...}))))..))))))).))},)},)))))).)))))),),}))))))))))..,)}})))}}))))}}}))))))),.,,,})}})}))}})}.)))))))}}),..)))))))),,.))}..,....}}))))}}..}),)})))))}}))}..}})|}).)))))),,}}))..}))))}}}))))),.)))),,}))))(((((((((((((((....{..(((((.((((((((,,({(.......})).))))).)))))))).}))))))))).))))))....,(((((.....)))))))))))))))...})}....})}|((((((.(((((((........,{{,|,((((,,((((.{(((((((((((((((((((.(((((.,((((...,.....(((.....))).....,....)))),))))).))))))))).,{,.(((((((..(((((...)))))..)))))))...|||({((((.{.......(((..((.(((((......))))).))..)))(((((((.{((.(((((((((((....((((((((.,....}.))))))))....)))))))))))..))}.))))))}.......(((((((.,.(.....(((((.(((((.(.(((((((.........))))))))))))).)))))....}))))}).,,,.,,)))))),,)))))))))),).)))))))).)))..(((((((..((((((((((((..,({,.((((.{{{.,{,............,,,,||},||||..||{{{,...,||...,,{(((,{,,,,,..,,,......,,||}|{.,{{{,{,......(((((((((.(((..{{....}}...))).))))))))).....}}},)}....))},..,|||,|,||},},,,,}}}|.,,,},},}}),},|{{{{(((((((((((((((..((((..((((.......))))..)))).,,,......}}}....,,,...,,,|...((((((......)))))).,|||.{.((((((..(((...)))((({.,(((((....)))))))))(((((((..{((.{(((........)))),)},.(((((((.....)))))))((((....))))......(((((((.((((..(((..........)))))))))))))).......{{(,,,|||,,.....{{{{{,,,,,..))))))))))))))))))}.}}}(((((((((((((....))))){(.....))...........)))))))).........)))))))))))))))..((((((((({....}})).....)))))),)}}}}.,{{{(((.((.(((((.....((.((((((((((........)))))))))).))...,..)))))..)).)))...,,}}}.{(((((({(((((({{(({{........}}}}........{((((.((((({..((((,.,{..{,(((((.((((((((.(((((.({....}})).))).)))..)))))....))))),.}))))))))))).))))}..(((({......)))))...{(((((((.({...(((((((((((((..........))))).(((.(((((..((.(((((((((,,{(,.{{....})..}}.)))))))..)).))..},)))).)))....(((((......)))))...)))))))).)}...))))))))).))))))....{{{{.......((((((((((.,,.((((......})))..{{{{(((((((((((.........)))))))))))).}}})}))))))))))...}}}}.})))))))........)))))))}.,))))))))))))))))))..))))))}))))))).))).}}))))).))).))))...)))))}.....)))))))))))))))).)..)))...))))),,.)))))),....(((((((....)).))))){({{{.........}))))....}))))).))))))..))))))).)).))))))....))))))....))).)))...)))).)))..{{{.((({{,.,,((.,{{{,,(,,(({{,{|||({({{{,{{,,{,|||||||||{,|},,|)}.}},))))|,.((((((((.......)))))))).))}},,))},.}}}})),)))}..}))))).,.((({.((((((.((((((((..(((((.(((((((((,(((,,...))),....,{{.((((((({{.(((.(((.....,,.{(((({....)))))).{({(({.....{{{{((,{((.((,.,.((((((,.,(((((((,....||}}}||}.}}}}}}....}}}}}.....,{{{{{.{({({.,(|{{{|,{(({({{{{|{|((({({{{{{.{{|{.{((,{{{{(((((({(,|((({{,|||.{||.,{,,(((((.((({,{(((...((.((((((.(((((((((((....)))))}...{{{((,.{,.,|||}},((((((,{{(((((....)),,}}|||.,,,.....,}})))},..))))))..,,.......,))))).)))))).))...)),.}})))).))))),,||,..,|||||,..,,{{,.,,{.{.||...,|||,|}}.)))),}}}))}})})})).}}}}}...}||||||||.}}}}}}}}}|}}|||||,((({{{{{((((({.(((({{{(((((...(((.(.(((..((((((((((((.......))),}))))).))}..))).).)))...))))))}.)))).}))))}.,,,,|}}})))))......||||,||||.....)},.}.))))||||,,,,,...)))),,..,))))},..((((.....)))),,,..))).)))}).)))))))..))))))))),})).))))).))))))))...)))))).})))))).,.))))))))........)))))....}))).)))))..))))))))).))))))))))))))))...))))))..))))))))))..))))).,.))))...}.)))))},))},.}}},.}}}}),,,,))))),|((((((...(((((..((((.......))))..))))).,.))))))}......})))}}.)))))))}}||((((((((,...}})))))))){((((((..(((((.((((((((.......)))))))).)))))...))).))))......(((((......))))).....,},,,,,.)))))).).)))))}).,))))))))))).))))))))))))))).)))..)))))...)))))))))....,,...((((.(((((((((((((((((((((({..,,||,,,.{{{,,{{,{({((.....{.({(((..,.||}}},,....})))}..}.},}),..))}.))))}}.},}.....(((.(((((..((((((((((({..........((((.....))))....{((((((((..((..{{.(((((.((((..({.{((((((((((...})))))}((((....))))((((..,,.((((((((((((((((((.(((({,.,{.{(,,.{{{{.,{{{{,...,)))).,)))}..,}},}}...}))))...)))),.,)))).....))))))))).,,.)))).......(((((((((((((((((((((((((((((((((((..(((((((..(((.,......,)))..)))})))}...))))))))))|..|}}}}}}},}...(((((.....)))))...............................,||{........................((((((({(({|........,,,........,}|.{{..((((((((((.((((.((.,,{...{(,,{...(((((((..((((.((((.......)))).))))..)))))))}))}.,})..))}))).))))))))))..}}.....,)))))))))),.........,,}})))))))))))))))))..((({...})))....,))))}..))))))))).}}))..))))))))|((((....(((........(((((((..(((............)))..))))))).......,.)))..))))...)))))))))))).))))).))).,.{((((((((((((......{{{...,,,||}....{{{||,,,)}})}..{((((({..{((..{{(((((((.......(((((((((.....))))))))).{{((((,,({.......((((((((......)))))))}.....||,,,,,}}.((((((((((....(((((((({...}))))))))........((((((((.(((((((((((((......))))))))){{{{......(((((((.,,,({{(((((((((((((((((..((((((.(((......))).(((((({(((((((..,(((((..({.(((((((.(((((........))))).)))))))..)}.)))))|((((((((((...............))).)))))))}...))),))},..,}})))))).,(((((((...((((((..((({......,)))..)))))))))))))))))))))))))))......)))))),,....))))}).))))))).....}))}..)))).)))))).))(((((((.{(({(((((((....)))))))))}...)))))))))))).))))).,,||,,}}}}}}..,,}}(((((((..(((((.....))))).))))))).(((((...)))))))))))).}}..)))}}))))..........))))))))))))),})))))))...)))))))))))).))))...}}(((((..((((....((((((((((..(((..........(((((((((.........)))))))))..}},})}..)))))))))))))).)))))........,{{{{,....}}}}},.

Transcripts

ID Sequence Length GC content
AAUCAUGGUGCCGCUGGGGAGGGGAGAAGCUGCUGCUGCCGCCGUUGCC… 7937 nt 0.4660
Summary

This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]

Forensic Context

A study in human HT-29 colorectal adenocarcinoma cells demonstrated that arsenic trioxide exposure induced a 22.88-fold upregulation of the MTF1 gene, a transcriptional regulator of metallothioneins, as part of a systematic evaluation of metal-specific gene regulation [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In a separate investigation of human sepsis, bioinformatics analysis of peripheral blood mononuclear cells identified the MTF1 as one of six key diagnostic cuproptosis-related genes, where it showed a major distribution in monocytes, T cells, B cells, and NK cells and its expression was statistically validated in an independent cohort [Wang et al. DOI:10.1016/j.heliyon.2024.e27379].