Basic Information

Symbol
MTPN
RNA class
mRNA
Alias
Myotrophin GCDP V-1 Granule Cell Differentiation Protein Protein V-1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_145808.4
Sequence length
3782.0 nt
GC content
0.3926

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1001.70 kcal/mol
Thermodynamic ensemble
Free energy: -1084.49 kcal/mol
Frequency: 0.0000
Diversity: 1070.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((...(((((((.((((..(....)..)))))))))))...)))).(((((((((((((..(((((....)))))............))))))))).))))..(((((..........)))))........((.(((.((((.(((..((((((..((((.(.(((((((.((((...((((.((((((((......))))))))............((((..(((((.((((....)))).).......)))).)))).))))...))))..))...))))))))))...))))))...))).)))).))).))...(((((((((((((((((((((((((.(((((((.((((((((((((((((.(((((((...(((((((((..(.((((((..(((((......))))).)))))).)..((((((........)))))).(((....)))................)))))))))..)))))))....)))))))..((((((..((((.((((((.(((((..((((((..(((((((.((((..(((((((((..((.(((((.(((...........)))..))))))).......((((((((((((((.(.((((((.(((.(((((((.((((........(((..((...))..))).........)))).)))...)))).((((......((((((((((...(((((((.(.((((((((((......((((.((.((((.....((((((...........))))))((((((((.((.(((...(.((((((((..(((....)))..)))))))).)....))).))))))))))......((((((((((((((((((.(((((((.(((..((((...(((((((((..........(((((((.((((((((((....))))..(((((.((.(((((..........)))))...)).)))))...((((((((((.((((....))))))).)))))))...........)))))).)))))))...(((....((((((((....((((....(((..(.(((....))))..)))..))))..))).)))))..))).....(((...(((......((((((((((.(....(((((((((.....)))))))))....).)))))))))))))...)))...))))))).....))...))))..))).))))))).....(((((.....))))).....(((((((((((....))))))))))).....(((........)))((((((.((((((((.....................)))))))).))))))((((((((((.((((((((((((...))))))(((((....)).))).((((((((((............(((((...((((.(((((....((.......))...)))))....))))....)))))))))))))))...)))))).)))))(((..(((((.((((((((((((((..(((((((....)))))))...((((((...(((....))).))))))((((..(((.........)))..)))).((((((.((((((.((....))..)))))).))))))....)))).....))))..))))))))))))))(((((..(((....)))..)).)))..((((((((((((.(((...............(((((((((((.((((((((((((.....((((......))))...)))))))...((((((.(((((((.((((.....(((((((((...(((............)))...)))).))))).....))))))))))).))))))...((((.((........)).))))..........((((((............))))))(((((.((((((((.(((......(((((................)))))(((.(((...))).)))..(((.........)))))).)))))))))))))((((...))))(((((.....)))))......))))).)))))))))))...........(.((((((...(((.......)))......)))))).)..............(((((((((...))))))))).))).)))))))))))).))))))))))))).)))))))))))))).))))))....))))))))).).).)))))))...........((((...............))))......((((.......))))...............((((((((..........)))))))).))))))))))......))))..(((((.((((((....)).)))).))))).....))).)))))).))))))).))))))))..........(((((...(((((..(....)..)))))..)))))))))))))).(((((....)))))......)))).)))).)))..))))))..))))).)))))).)).))(((.((((((...(((...))))))))).)))..)))))).)))))))))..))))))).))((((((.....))))))(..(((((((.((..(((((....(((((.((((..(((((((..(((((.((((((((.....(((((...(((((.((((((((.((((((((((.......))(((.(((((......))))).)))....((((((.......(((((.....))))).....((((....))))))))))..........)))))....))).)))))))).(((((.(((((((.............((((...))))...............))))))))))))...))))).)))))..........)))))))).)))))..)))))))....)))).))))).....)))))..)))))))))..)((((((((.....(((((((((....(((((..((((((..(((....(((((.............)))))..)))..))))))..))))).........((((((((......((.(((((((((...))))))))).))))))))))..))))))).))...((((((((((..(((((.((((((.((((...(((..((..((...(((((.......))))).))..))..)))...)))).((((((((....(((........))).)))))))).....))))))))))).....)))))))))).......))))))))......))))))))))))))(((((.((((....(((((...............))))).....)))).)))))((((......))))..((((((.(((((..((((......))))..))))).))))))(((.(((((((.((((..((.(........(((..(((((....))))))))...........(((((((((((((((..(((((((((((...((((((............)))))).)))).)))))))..))...(((((.....)))))..)))).)))))))))...............((((......))))).))..))))))))))).))).(((..((((.(((((((..((((...(((((......)))))...)))).))).)))).))))....)))...........))).))))))
Thermodynamic Ensemble Prediction
.,{((({.{((((((,((((,,(,,,,|,,}|||||}}}}}.||||||{{{{|(((((((((..,,{((,...|||||{{,,,,...,..})))}))}),))))..{{{{(,.{,,,...,)))||,,,...((.((((((..((((((((((((((..((((.(.(((((,(,((((.,.((((.{(((((((......}}}))))),....,......((((..((((,.((((....)))).|,...,..)))).)))).))))...))))..,,.,,))))))))))...))))))(((((.{.{,(({......)}).).})))))))))))))((((.....)))}..)))))).)).((((({{.{{{{{{{...{((((((((.,{,((((((..(((((......))))).)))))}.,..((((((........)))))).(({....}}}.......,,,,|,.,.}}))))}}}..}|||||}....||||||}{{{{{{,,,{{{,,.{({,,.{(((((((({,..,,,,{{{(((((({(((,,{{{,,|,..|||||{({.{{{..|{.,...,})))..)))}})}.....,,,(((((((((((((((({........}}}(({{((.....))))).((({{....,...}}}))}})))))))))))))}.,,,,,}}},|{|({.....|||}.....,...{||{{||}|,||||||||||,,,||,|{{..{,.,{{{.....((((({.,,.....,}.))))))||||||||,{,.{||,,,|.((((((((..(({....)))..)))))))).,....}}}.}}||||}}}}...,..{{{{{{{{{|{{{{{{{|,|||||{(.{((..((((.,,((((((((,.,,{{{....(((((((.(((((({(({....,}}),.|{,{{.{,.(((((..........)))))...,}{||||,..,(((((((((,{((((....))))))).))))))),..}))}}...}))))).))))))}..,(((,...((((((({.,..((((....(((..(.(((....))))..)))..)))).}))),}))))..}||,|...||||{{{,,.}}...||||((((((.(....{((((((((.....)))))))))....).))))))||||....}})}}.,,)))))||,||,,||,,,|}}|,,}}}.}}}}|||,,,..(((((,...,))))).....(((((((((((....))))))))))).,,,.{,....,,.,,}||{(((((.((((((((..,.........,........)))))))).))))))|,,{{,{{{{,.{{{{,((((({...}))))).{{{{|,,|},.}}}.,}))))|{{({.,,,,,,|||||,((((,,.(((((((((({,,.({.((((((((((..((...,,....,.,....))..)))))))))).)),,,,.,,...(((..(((({{((((((((((({{{..(((((((....)))))))...((((((...(((....))).))))))((((..(((.........)))..)))).((((((.{(((({.,{,...,..,)))))}.))))))....}))}.....))))..))))))))))))))}}},...,})))))))))).,)))}..((((((((((((.(((,{{............(((((((((((.(((((({(((((...,.{{{|,,....}}}}...,}}}}||...((((((.(((((((.{(({.....{{{{{{(({...{{{........,...})}...)))).})))}.....}}}}))))))).))))))...{(((.{{........}}.)))}..,,{{{{{,(({{{{.,..|,,.,|,|}}}},}(((({{((((((((.(((......{(((({{.,......,.,|..}}})){{,.{{.....}}..})..(({.{,...,},)))))).)))))))))))))||||...}}})|,|||}}},,}}}}},,...}))))).))))))))))).,|........,.((((((...,{{.......},}..,,..)))))),|,.............{((((((((...))))))))).))).))))))))))))||,|||||||}}||,|||}}}}}}}||||.}|||}|||,.}}}}}}}}|.},|.}}}}},,........}}.))}},.,,}))..,,...,|})||,}}}}||||.....},)))},}|..,...,.{{{{(({{{{{,,|}}},.,{{|||,,,,,.))))))))}},...,{((((..(((((.{{{{{{....)).)))),))))}....))))})|||||,,,,,...,,,..}}}}}......||,.||||,,,)))}}}},,.....((((((((((((((((((.....{{{{,,,,.{,,(((.((((((((((....))))))}}))}..}}}..||||{{{,..{({{{..((((((..,(((..,|..,,,,,....}}..)}}}))))}}.,,..,,})))}|,|||}||||,,,{||},,}}}}},{(((((,,({..(((((....(((((.((((..(((((((..(((((.((((((((.....{((((.,,(((((.((((((({.{{{{((((({.,,,...}}(((.(((((......))))).))}....((((((({.,.,,(((({.....,,,,..,,,}||||}...),))))))))...,,,....})))},,,,)}},|}}}}|||.(((((.(((((((.{{,.........{{{{...}}}}.....,,...,.,..))))))))))))}}}}}}}}.))}}}.,|,......)))))))}.)))))..)))))))....)))).))))).....)))))..)))))))})|||,,,,.}}}}||..,{|||||||....(((((..((((((..(((....(((((.............)))))..)))..))))))..))))).........{(((((((......({.(((((((((...))))))))).)}))))))))..,}}}}}}.,,..,||((((((({,{((((..((.,,({((,..,,,{,,{({{{({{{,({(((,......}}}||{||....||}}|...,{({.((((((((....(((,,...,,.))).))))))))}}}.{|,|||{||{||{.{{{||||{{|{......)))),,))))))}.)}))),))}}}...,}..,{|||,|||||.,,}}}}))),},,,,.}}}}})),.......))}).,}}..))))))))))))....((((((.(((((..((((......))))..))))).)))))))))))),})))))))))))...........(({..(((((....}))))})),,,,,.,...........,,,,,..,,,||||||||}.,}}}}||||{,||.......,{|||||..}}}}...})}))))}}}..{((((.....))))}..|{,,,,,,,,|||}}|....,,{|||..{((((......))))}..}|||||},,}}},..,},}|}}.}||||,{||,|||}}|{,{,,,||||,.,}}},)))}|,,|))|},)}|||}}}.}}}}...})}},,,,}}})))}}}}}}})}}.

Transcripts

ID Sequence Length GC content
AAGUGUAAAGGUUCCUGCCUCUCCUCGGCCAGGCGGAACCUCUCUGCUG… 3782 nt 0.3926
Summary

The transcript produced from this gene is bi-cistronic and can encode both myotrophin and leucine zipper protein 6. The myotrophin protein is associated with cardiac hypertrophy, where it is involved in the conversion of NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers. This protein also has a potential function in cerebellar morphogenesis, and it may be involved in the differentiation of cerebellar neurons, particularly of granule cells. A cryptic ORF at the 3' end of this transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the MTPN was predicted as an upstream regulator with a negative activation score in the prefrontal cortex under conditions of both E2F3b overexpression and cocaine self-administration [Cates et al. DOI:10.1038/s41386-018-0296-1].