Basic Information

Symbol
MUC1
RNA class
mRNA
Alias
Mucin 1, Cell Surface Associated KL-6 PEM EMA ADMCKD1 ADMCKD Ca15-3 CD227 MCKD MCD PUM Tumor-Associated Epithelial Membrane Antigen Breast Carcinoma-Associated Antigen DF3 Peanut-Reactive Urinary Mucin Polymorphic Epithelial Mucin Carcinoma-Associated Mucin Mucin 1, Transmembrane Krebs Von Den Lungen-6 Cancer Antigen 15-3 Episialin CA 15-3 Mucin-1 H23AG MCKD1 MUC-1 PEMT Medullary Cystic Kidney Disease 1 (Autosomal Dominant) Tumor Associated Epithelial Mucin Epithelial Membrane Antigen Tumor-Associated Mucin CD227 Antigen H23 Antigen MUC-1/SEC MUC-1/X MUC1/ZD ADTKD2 MAM6
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_002456.6
Sequence length
1199.0 nt
GC content
0.5513

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-446.40 kcal/mol
Thermodynamic ensemble
Free energy: -464.18 kcal/mol
Frequency: 0.0000
Diversity: 358.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((((((.(((.((((...((((....((((((...((((.((((((.(((....(((((((((((((.(((((..............((....))..((((((((.(..((((.(((...(((((((((((.((.((((((((((...)))))))..(((((((((((((.((..(((((...(((((((........))))))).......)))))..))))))))))))))).......((((.(((((((.....((((((((.(((((....((((.(((.((.((........))...)).)))))))(((((((..(((((((...)))))))))))))).....)))))..))))))))(((.(((((...(........)...))))).)))...((.((((.(((.((((.....((((((...))))))....))))))))))).))))))))).)))).................(((((..(((..(((.....((((((((........)))))).))...))).).))..))))).......((((......))))(((((((..(((.(((((...(.((((..(((.(.((((..(((((((((....(((((....(((((.............((((((((((.(((............)))))))))))))))))).....))))))))))))))..)))).))))..)))).)..))))))))..))).)))).(((((..(((((((((((.((((.(((..((((((...))))))...)))..))))))((((.((.(((....))).)).)))).........((((((((((......))))))..)))).)))))))))))))).(((((..((((((...((....))....))))))..)))))...))))).)))))))))))..)))..))))..).))).)))))))))).)))).))))(((((....))))).(((((((.(((((((....((((.((.(((((....))))).))))))....)).))))).))))))).)))))..)))))))))..)))).))))))...))))))).).))).(((.((.(((((......))))).)))))..)))).)))........((((....))))........
Thermodynamic Ensemble Prediction
..,,,,,..,(((((((.{(({{((({,.,{{{....((((((...{(({.((((((.(((....(((((((((((((.(((((.,,,..........((.,,,|}..,,{{((((,(..(({(.{{{.,.(((((((((((.{{.,{{(((((((...}}}||||,,(((((((((((((.((..(((((...(((((((........))))))).......)))))..))))))))))))))}.......((((.(((((((.....{(((((((.(((((....{,{{,(((.{{.{{,,,,....},...}}.,},}}}}((((({{{{(((((({...}))))))))))))).....}))))..)))))))|(((,(((((...,........}...)))))})))...((.((((.((,{((((....,((((((...))))))...,))))))))))).))))))))).))))........{,......,(({((,,{{|,,{{{.....{{((((((.,,...,,)))))).))},||||,||}|,.,}}}}.,,,.,,|(((....,,)))}{((((((..(((.(((((.,.{.((((..(((.(.((((..(((((((((..,,(((((....(((((.............|(((((((((.(({.,........}.))))))))))))||)})}.....))))))))))))))..)))).)))}..)))).},.))))))))..))).)))}.((((({.,,||||||({{.((((.(((..((((((...))))))...)))..))))))|{{{.((.(((....))).)}.}}}}.,...,,,,((((((((((......)))))}.,,|||,|||||}}}}}||||}|{((({{((((((......{{{|,.....)))))})))))),}}),,},,)))}))})))),})))..))))..),))))}))))))))).)))).))))(((((....))))),(((((((.(((((((,.,.{(((.((.(((((....|)))).)))))}....}),))))).))))))).)))))..))))))))).,)))).)))))),..})))))).)}))).{{|,||,(((((......))))).}}|}}..}})),,}}.......,((((,...}})),}}}....

Transcripts

ID Sequence Length GC content
ACCUCUCAAGCAGCCAGCGCCUGCCUGAAUCUGUUCUGCCCCCUCCCCA… 1199 nt 0.5513
Showing 21 to 21 of 21 entries
Summary

This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]

Forensic Context

No relevant information is available at the moment.