| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCUCUCAAGCAGCCAGCGCCUGCCUGAAUCUGUUCUGCCCCCUCCCCA… | 1199 nt | 0.5513 |
This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
No relevant information is available at the moment.