Basic Information

Symbol
MUC13
RNA class
mRNA
Alias
Mucin 13, Cell Surface Associated Down-Regulated In Colon Cancer 1 DRCC1 Mucin 13, Epithelial Transmembrane Mucin-13 MUC-13 RECC
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_033049.4
Sequence length
2879.0 nt
GC content
0.4467

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-805.80 kcal/mol
Thermodynamic ensemble
Free energy: -865.02 kcal/mol
Frequency: 0.0000
Diversity: 709.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((((((((((((.((((((((.((.(((.(((((........))))).))))).)))))))).......((((....)))).........(((((...(((((((.(((((((...(((((((.........)).)))))..)))))))....))))))).......((((....))))((((....((((........)))).....((((((..(((((.(((...((((...((((............))))(((.((((((((((.(..(((((.((((.((.((((((.(((((((((((...(((((((.....(((((((..(((.(((((.((((..(((((((.......((((......)))).................(((((((((((((.......))))))(((((((....((((((((((.............(((......))).(((((((((............((((((.(((...)))..(((((..(..((.((((.((((.((..........))...)))))))).))..).))))).))))))...(((((((.((((.(.....).))))..)))))))....((((..((((.(((((((((((((((.........)))))))))...........(((((((..(((..((((....(((((((.(((((.(((((....))))).((((((........)))..))).......((((..((.(((((....)))))))..))))..((((((.......))))))((((((((..(((.......)))..))))))))...((((((((((.....((((.....(((....))).((((.((((((.(((....))).)))))).)))).))))........))))))..))))..))))).)))))))...............((((((((.((....)).)).))))))...((((((..(((....)))..))))))....((((.(((((....((((....)))).....)))))))))..((..(((((.........)))))..))....))))..))).)))))))(((((((.....(((...........)))....)))))))..)))))).)))).))))...........)))))))))..((((.(((.((...........)))))))))...(((((..((((((..((((((........))))))((((((.(...).))))))..(((((...(((((.(((.(((((....)))))....))))))))..))))).))))))((.((((((((.....))))))))..))....................))))).....))))).)))))))))))).(((....))).............))))).))..))).))))...)).)).))))).)))..((((((((....(((((........)))))..)))))).)).(((.(((...(((((((((..(((....(((..(((((.(((..((.....(((((..((((((.((((...)))).(((((((..(((((.((((((..(((.....)))..)))..(((((((((..(((((.........((((.......)))).))))).)))))))))......(((.....((((.(((((((((.((((.(((((((....)))))))...)))).......((((((...((.((((((.((((...)))).)))))).)).))))))....))))))))))))).....))).(((((((...))))))).))).))))).))))))).)))))))))))..))..))).)))))..........(((((........))))).......((((.((.(((((....))))).)).))))..((((((..(((((((...((((((.(((......((((.....))))....))).)))))).((((.((........)).))))....))))))).))))))....)))....))).)))))))))...))).)))(((.((((...)))).)))....((((.(((((.......))))).))))......(((((.(..((((((.(((...(((((....))))))))))))))..)))))).....)))))))..)))))))...)).)))))))))...))..(((((.......)))))....)))).))(((((.(.((((((....((((....))))..)))))).))))))..............))).).)))))..).))...))).))))).)))((((((....((((((((((.((.((((((((..........))).))))).))(((((..........)))))..)))))))))).....)))))))))).)))..)))))))))))................)))).......))))).))).)))))))....))))....(((((((((((((((....(((((((((((((((((..(((((...(((.((((........((((.((((......(((((...((((((((.((((..((((((....))))))....)))).)))).))))........)))))......)))))))).......)))))))....)).))))))))))))))..((((..((.(((((...............))))))).))))))))))......(((((((((.((.(((((((((((...((((...))))...))))))))))))))))))))))))))))))))))))).
Thermodynamic Ensemble Prediction
....,,,,({{{((((((((((.((((((((.((.(((.(((((........))))).))))).)))))))).,.....{(((....)))|,,.......,{|||...(((((((.{((((((...((((({(.........}).)))))..))))))}....))))))).......({{,....,}}},,||....((((........)))).....((((((,.{((({.{(({{,((((...,{,{............}}},(((.((((((((((.{..(((((.(,((((((((((((((((((((((((...(((((((.....{((((({..{{{,(((((,{{({.|((((((,.......{(((......)))),{,,.{{{{{{......,,,,,,,((((((.......)))))),,,,,,,.,,{((((((((((,..,,.....,...,...,...{|{..,,....,.,|,,|{||,||{{{{,(({((((,,{{|.,((((,{{{..,..,{||.|{||,|{..........||,,,||||}}}|{{|...,))),..}},},..}}|||||{(,,,,,,|{,,,{|{||,,..}})))))}}.....{{(((((.|(({|.,((((((((.........))))))))))),))))))}.(({{.,,..}}}),}}}}}((((((..(((((((..(((((....))))).((({{{,.......)))..))).......(((..((({((((((((((((.((,{((((({.((((((.......)))))).,,..,}))))).)))))))).)))))))..)))..))})))))))..)))))).....{(((((((,(({{{,..{(((({.,,|,}}}},.,|,|||.{((((((((...(((..(((..,.........{{({.(((((.({..........{({{{((((((((.((....)).))}}}))),.,{(((((,..(((....))},,}}}}))}}}}|(((.{{{{{,...((((....}}|},,,..|||}||||}..((..(((((.........)))))..))}},,.}},,,}|},...,)))),))))))))))))).},,}}.(((((..(((.((,{(((((.(((((..((..((((.,,.........},,,.})))...))..)))))))))))))..)))...)))))...,)))..)))...))))))))).}}|{|((((({(({({{(,(..,|,||||||.,{{{||,|.{((((.(((.(((((....)))))....)))))))).,))))),,,,||,||}||||||{||}.,||}}}}))}..}},,,,||,..............,....}}}.,}}}},}}}}|||||||,.,,,....,))....,,......})))))}))..,||||||,...,,.))}))),}.|||{{{,,{{|||}},.{((((.,......)))))}}),,),,,))}|||}|||...{{{{{{{{,..{,{.,|,||||||||,,.{({||||,,{..{((({..((((({.((((...}}}),||{({((,.(((((.((({((..(((.....)))..))}..{{{{{{{{{{,(((((,,,.,{{,.((((.......)))){|}},,,))))))))).}}}}}{((.....((({,(((((((((.((((.(((((((....)))))))...)))).......{(((((.,.((.((((((.((((...)))).)))))).)),)))))}....))))))))))))).....))}.(((((((...))))))).))).))))).))))}}}.)))))}}))))..,..})))})))).....}}}}}}||{{,.....,}}))},}|||,...||||.{||,,|{{..,((((|,....)))),.{(((({..(((((((...((((((.(((..,...((((.....))))....))).)))))).((((.((........)).))))....))))))).}))))),,.||||....})),))})))))}...|||{,,.(((.((((...)))).)))...}|||..|||{{....,||)))))|,,)},.....(((((.{..((((((.(((...(((((....))))))))))))))..}))))).,},,))))}}}..))))))).,.)).)))))))},.......(((((.......))))).,}))))){((.((((..{((,,......,)}}.)))))))...))))))),}.||..............})).}.)))))..}.))...))))})))).)))((((((..,,(((((((((({((.((((((((..........)))},)))).,)||||{|,........,))})..,}))))))))..,,.)))))))))).,))}}))))))))))).,..............}))),},,...}}))).))).)))))))....)))),...(((((((((((((((....(((((((((((((((((..(((((...(((.((((......,.((((.((((..((.{(((((...((((((((.((((..((((((....))))))....)))).)))).))))..}}}..,).}}},,....)))))))).}.....)))))))....)).))))))))))))))..((((..(,((((((.,.............)))))),.))))))))))......{(((((({({({,((((((((((,...{({{...,}}}..,})))))))))))))))))))))))))))))))))))).

Transcripts

ID Sequence Length GC content
AUCAUUUCCUCCUCAGAUUACCAAGCAAGAACAGCUAAAAUGAAAGCCA… 2879 nt 0.4467
Summary

Epithelial mucins, such as MUC13, are a family of secreted and cell surface glycoproteins expressed by ductal and glandular epithelial tissues (Williams et al., 2001 [PubMed 11278439]).[supplied by OMIM, Jul 2008]

Forensic Context

A study in humans developed a multiplex RT-PCR assay for rectal mucosa identification, where the MUC13 was selected as a candidate marker based on high expression in the rectum and was positive in 17 of 19 rectal mucosa samples, with a cutoff value for normalized peak height set at >0.1, and it showed no cross-reactivity with other forensically relevant body fluids except for a slight peak in 1 of 10 semen samples [Akutsu et al. DOI:10.1016/J.Fsigen.2022.102712]. Another comparative study evaluating mRNA-based methods noted the MUC13 is mentioned in the literature as a useful marker for rectal mucosa, though it was not experimentally studied in that work [Martin et al. DOI:10.1016/j.fsigen.2025.103297].