Basic Information

Symbol
MUC21
RNA class
mRNA
Alias
Mucin 21, Cell Surface Associated Epiglycanin C6orf205 BCX31G15.2 Mucin-21 MUC-21 Chromosome 6 Open Reading Frame 205 KMQK697
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution

MANE select

Transcript ID
NM_001010909.5
Sequence length
3651.0 nt
GC content
0.5412

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1220.40 kcal/mol
Thermodynamic ensemble
Free energy: -1288.21 kcal/mol
Frequency: 0.0000
Diversity: 1082.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((..((((((.....))))))(((((((..((..(((.(.(((((..............))))).)))).)).)))))))..((..(((((..((.(((..(((((((((((.(((((.(((..((((((((((((.....((((((....(((((((((((.....)))))).(((......((((..(((...((..(((..((((.(((((((((....((...((((((......((((((((((((((((.......)))))....((((.......(((((.........)))))......))))...(((((((..........(((((((((((((((((..((((...))))....))))..........)))))))))))))((((.(((.((((((((((...(((..........)))...)).))))).))).))))))).)).)))))...(((((.(((((..............((((...........)))).))))).)))))..((((((......(((((((.......((((........((((((((((....(((.((((((((.......))).)).)))..)))...(((..((((.((..((((((..(((((((........(((....)))......(((((.(((((((.....)))).))).....((((((..(((........))).(((..((...(((.(((.((..(((...........))).))))))))..))...)))....((((.((((......((((((((.....))...))))))......)))).))))........((((((.((((((...((..........((((.((((................((((((((((...(((.(((.((..(((((......)).))).))))))))..)).))))).))))))).))))(((.....((((((((((((((.(((.(.(((.(((.((..(((((......)).))).)))))))).))).).))).))).....((((((((((.((.((((.((((((((((..............)))).)))..))).(((......))).....(((.(((.(((...(((((.((((...(((((((((((((((.......))).)))..(((.(((((.(((.......(((((((((.......))).)))...))).(((..((..(((((..((((((((..((...(((.(((.((..(((...........))).))))))))..))...))).)).)))..)))))..))..))).((((((.(((.(.((....(((........(((.((.(((.((.(((((.((((.((((....(((.((((....(.(((......))))....)))))))........((((..((.(((.((...)).))).))...))))((((..(((((.........(((....))).........))))).))))................)))).)))).)).))))).))).))))))))....)).).))).))))))((((((.............))))))....))).).)))).)))......)))).)))))...((((..(((((((...)))).))))))))))).)))))...))).))).))))))).)).))))))))))(((((......)))))(((((.(((....(((......)))....)))))))).............(((((..((((......))))..))))))))))))).....))).)).)))))).))...)))))))))).....(((((.(.(((((........))))).).))))))))))((((((((((((......((((........)))).((......(((((.((((((((......))))))...)))))))......)).((((((((............)))))))))))))).(((((.((((((((.......)))))))).)))))...........((((...((((.((((...)))))))))))).........))))))....................((((...................)))).)))))))..)))))).)).)))).....)))(((((.....))))).....((((.....)))).))))))))))....)))).......))).))))...........((((......))))..)))))).))))))))))).....))))))))...))))))))).))))..)))..))...)))..)))))))..)))))..)))))))))))))))))).((((((..(((((..((((((((((((((.......((((((((.(((((((.........((((.(.........).))))....((((((.((((((.((..(((.((..(((((((((.((((.(((((((.((((.(((((((((((((((............((((.(((..((..((((((......))))))..)))))))))((((....))))((.((((((((.((((((((......)))))).)).))))))))))...((((.((..(((.(((((....))))))))))))))..((((.(((((........))))).))))......((((.((((..(((.(((...(.(((((((((.((....)).))))).)))))...))).))))))......).))))((((((((..((((((.((((((((.(((((((...((.(((.(((((((.....(((((...((((((((((((((..........)))))))).))))))..))))).((((((((((....))))))...............(((((((....)))))))........((((....)))).((((((((.((((((...(((.......)))))))))))))))))))))..((((((.((((.((((...(((...)))...)))).)))).))))))......(((((((.((.......)))))))))))))))).)))))))))))))))))).........)).))))))..))))))))(((((....)))))))))))).(((....)))((((...))))...........(.(((((((.....))))))).).((((..((((..........))))..))))..)))))))).))))..)))))))..)))).)))....)))))))))))..)).))))))..(((((((...)))))))..))))))((((....))))..))))))).)))))))).......)))))))))))........(((.....))).))))))))..)))))).........)))))))).((((....(((........)))...))))....(((((......)))))...((((((((((....)))))))))).)))))))))))..)))))....))))).))..............)))))).((((....)))).......((((((...))))))
Thermodynamic Ensemble Prediction
((((((..((((((.....))))))(((((((..{{..(({,(.(((((..............))))).)))).}).))))))).,((..(((((..({.(((..(((((((((((((..,,.}},,{((((((((((((.....((((((....{{{,{((((((.....)))))},({{.......((({{((.....|}}|||}.,{||,|,{{|||(({{{{(({{{{,(((({{{{..((((((((((({((((.......))))},,{,{(((({,,{{,{{(({....,..{,||},,......,....,,{{{{{||,....,},..(((((((((((((((({..((((...))))....)))}..........)))))))))))))((((.(((.((((((((((...(((.,.......})))...)).))))).))).))))))).)).))))}.,,||{,({(({(((({(..........))))))}}}}....,|,,,..||||,|||||..||.,,||||.,.||||}}}}}}},,.||{,...,,,,.{|{{{{{{{,....,,,.{{((((((.......))).)),.}}..{{(({{((({.((((.((..((((((..(((((((......,,,,(((((((.(....{((.,,(((((({{.....}}}}.,},...,||.(((((......((((((({({(((({{{...({{.,,,.,,,.((({,,,,,.....,,,.}}||||||..,,...|}}.,,.{(((.((((...,..{(((((((....,)},..}}}}))......}))).)))}...,,.........{|||((((..,{.,.|||.||{..,{,({({{,,|...||,,,,...{(((((((((...(((.(({,{{..({(((..{{..|||,||.||||||||..||.|,|||.||},||,.|||||..,....,,|||,||||||||.|||.,.|||.|||.||..|||||..,,..))},}}.)))))))).))).}.))).))}.,,,.({{{{{{{{{.,(,((,,.,((({,((((....,.........)))}.}))}|}}}.{,{...,,{|||((...,,,.(((.(({.,.{{(((,({{{...|||,||,||||||||.......))).))}.,|{{|{{{{{|{,........,((((((((..,,...|||.|||.||,,|{(({..((..(({{{..{(((((((..{{...|||.|||,||,,||||,..,,.....}}}.}}))))))..}}...))).))},}}..)))}|..}}..))},|{{|||{({({({(,....{{{,,....||{,{|{|.{{,,{{,{{{{{{((((((..{,...(((.((((....({(((......))}}}}.,))))))|..||...}||.|},,,,{,({({{,.{{{.{{.{{(({.((((,(({{{{{((.........{{(.,,.}}).........}||||{(((.......))).}}....)))).)))).)).))))).))).)))))}))....}}.}}}}),}))))}((((((.............)))))).,,,}}),},}))),||||...}}))))}))}),.},|||{,,{{((((,...,))).)}}}}}})))).)))))...))).))).)))}))),)}.)))))))))).....}}}}|||||,.(((({,(((....(((......)))....)))))))).,..,.......}|||||},.,,,.{{{{{,,,,..))))))))))))......))))),,}}}}}},))....).))))))).....(((((.(.(((((........))))).).)))))|||,((((((,(((((({,..,,((((........)))),{{..,...(((((.{,((((((......)))))}...,}))))).,....}),||||||||}}}.,,}},,,,)||||,,,,)))),.{((((,((((((((.......})))}}}},|||||.......,,,||{|||,.((((.((((...)))))))),||,,.......,{||,....})},}}}}.........,}}}},............,,,..))))..)))))))..)))))).)).))))...{,...(((((.....)))))...,,((((.....)))).))))))))))....))))............(((((.........,{{{......}}))..)))))..)))))))))))....,}}}||||{{...))))))),.,)))..)))}}},,..,,,..,,.))))}))))),..)))))))))))))))))).((((((..(((((..((((((((((((((.......((((((((.((((({{,{{{.....((((.(.........).))))....((((((,((((((.(({,{((,({...((((((((.((((.(((((((.((((.(((((((((((((((....,,....|.((((,(((,.,{..((((((......)))))),.))))))))),{{{.,,.||||((.(((,,{{(,((((((((......)))))).|{{{{{{.,,,)),,}||}.{({..,||,(((((....)))))|||||||,,..{,((.(((({...,,,.,)))))})))),,...}||||}}}|.},,|{.{||..,}}|||||{(((,,({{.{||{||},},|||}|,,{|||,}||||,..|||,|,||||{(((((((..((((((.{((((({{{((((((,..,((.(({.(((((({.....{((((...((((((((((((((..........)))))))).))))))..))))}.,{{{((((((....)))))),,,,,,,..,...,,{{{((({....|}}}}}}...,....{{,|.,,.,))),(((((((,,((((((...(((.......)))))))))))))))))}}}}..((((((.((((.((({.,,{{,...)))...}))).}))}.)))))).....{(((((((.((.......)))))))))))))))).}))))))))))))))))),........}}.))))))..))))))))(({((.,,.}}}},))))})).{{,..,,|}}{,,,..,,||}{,....||,|,|,{{{{{|{.,...))))))).},)}||,,||||},....,)}})),),},,))},}})))))).))))..)))))))..)))).)))....)))))))))))}.)).))))))}.(((((((...)))))))..)))))){(((....))))}}))))))).)))))))).......)))))))))}}........,,{.....}}}})))}))))..))))))..,,.,{({({({(({(.....)))}.})))))}||||,,...,,})}}.,|||||,.....,}}}}...((((((((((....)))))))))).)))))))))))..)))}}....))))).}}.,,,..........}))))}.((((....)))).......{(((((...))))),

Transcripts

ID Sequence Length GC content
AGAGAAAGAGGCAACUACAUUGCCUGGAGGAAGCCUAAGGAACCCAGGC… 3651 nt 0.5412
Summary

This gene encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. The encoded protein contains an N-terminal signal sequence, an extracellular mucin domain, a stem domain, a transmembrane domain, and a C-terminal cytoplasmic tail domain. The mucin domain contains O-glycosylation sites and is polymorphic with isoforms containing a variable number of nonidentical proline-, threonine-, and serine-rich tandem repeats of 15 amino acids each. The aberrent expression of this gene is associated with lung adenocarcinoma. [provided by RefSeq, May 2017]

Forensic Context

A study in humans demonstrated that the MUC21 mRNA, used for vaginal secretion identification, exhibited cross-reactivity with saliva and menstrual blood and contained a microhaplotype where severe heterozygous imbalance was observed in complex mixtures [Yu et al. DOI:10.1016/j.fsigen.2025.103416].