| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUUGGUUCGGGCCAGCCGCCUGAGGGGACGGGCUCACGUCUGCUCC… | 4048 nt | 0.5919 | |
| GCACUUGGUUCGGGCCAGCCGCCUGAGGGGACGGGCUCACGUCUGCUCC… | 16756 nt | 0.5740 | |
| GCACUUGGUUCGGGCCAGCCGCCUGAGGGGACGGGCUCACGUCUGCUCC… | 3895 nt | 0.5915 |
The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist. At least two dozen transcript variants of this gene have been found, although for many of them the full-length transcript has not been determined or they are found only in tumor tissues. This gene contains a region in the coding sequence which has a variable number (>100) of 48 nt tandem repeats. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the MUC4 mRNA vaginal mucosa marker was detected in 55% of intimate contact samples (fingernail swabs, penile swabs, boxershorts) up to 36 hours post-contact, though it was also detected in one non-intimate contact sample, and it was characterized as the most sensitive but least specific vaginal marker, frequently detected in non-intimate samples and known to cross-react with other body fluids [Johannessen et al. DOI:10.1016/j.fsigen.2022.102750]. Another human study of vaginal swabs found the MUC4 marker was part of a 19-plex mRNA assay that correctly identified vaginal mucosa in ~85% of samples from pre- and postmenopausal women, with its amplification efficiency not differing between age groups but showing a significant relative increase in its signal contribution in postmenopausal women compared to premenopausal women [Chierto et al. DOI:10.3390/cimb45080411].