Basic Information

Symbol
MUC5B
RNA class
mRNA
Alias
Mucin 5B, Oligomeric Mucus/Gel-Forming MUC-5B MUC5 MG1 High Molecular Weight Salivary Mucin MG1 Mucin 5, Subtype B, Tracheobronchial Sublingual Gland Mucin Mucin MG1 Mucin-5B Mucin-5 Subtype B, Tracheobronchial Cervical Mucin MUC5B Cervical Mucin MUC9
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_002458.3
Sequence length
17911.0 nt
GC content
0.6454

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-6656.10 kcal/mol
Thermodynamic ensemble
Free energy: -6930.54 kcal/mol
Frequency: 4.09514e-194
Diversity: 5994.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.((((((((.(((((...(((..........(((((((.((........))))))))).(((((((((.(((((((.(((......))))))))))))...))))).))((((...))))..))).)))))....).))))))).))))))..(((((((((........((.((((((((((((..(((((..(((((.(((((((....))...(((((((..(.((((((((((.((.((((((((((.(((..(((((((.....((((((((((.((((((((.((((((.....)))............((((....))))........))).))....)))......((((((...)))))))))))).)))))))...((((......)))).....))))).))..))).))))).))))).(((((((.(((((.(((.(.(((....(((((((((((((((((((.(((...))).)))))...........(((((((.......))))))).......))))))))).)))))))).)))).)))))))))))).....(((((((((.....))))))))).((((...)))).)).)))))))))).)..).)))))).((.((((((((..((....(((.(((..(((...(((((((((((....((((....))))......))))).....))))))..))))))))).....))....)))))))).)).......))))).))))).......(((((..((((.((.((.......)).))))))..)))))..)))))..).))))).)))))))).((((((.((((((((((.....((((.(((((((((((.(((((...((((.(.((.(((((.((....)).)))))))).)))).((((.(((.(((((..(((.(((((...(((((.....)))))...))).)).))))))))))).)))).(..(((..((((((((((((((((.(((.((.((..((((...........))))..)).)).))).))))))....(((.((...)))))......((((((.((.....)).))).).))....(((((.(..((((((((..(((((....((((.(((((((((((........)).)))))).)))))))....)))))((((....))))....))))))))..).)))))...)))))))))))))..).)))))(((((...)))))......((((((((((..((((((((((((...........))))))).)))))...(((((((.((((((((..........((((((.(((.....((((((..((((((.((..((((..(((((((((.((.....)).)).((((((((..((((.((((((.(((.(((((((..(((.((......((.((........)))).....((((((..(.(((((((((..((.((((.....(((.((((........)))).))).((((((...............)))))).((((((......)))))).........((((((..((((..(((.........))).))))..))))))..((((((((..((((((((.(((((.(((........((.((((((..(((..((((((((((((.....((((((.((.(((((((((((.(((.........))).)..))))))).).)).))..))))))..)))))))...(((((.(((((((((.((((((...........)))))).(((((.((..((((((.((((.((........(((((..........)))))((((((..........)))))))))))).))))))..)))))))..........((((.((.(((((((.(((((((.....((((((...((.((..(((.....)))..)).)).))))....)).....))).)))).)))))))..))))))))))).)).)).))))).....(((((...((((((....((((((((((....((..((((.(((((((((((((((.........))))))..))))....)))))...((((((....))))))(((.((((((.((......((.((((((((.....)))))).)).)).)))))).)).)))...((((((((((..(((.......))))))))))))).............((((((((....))))))))))))..))....))).))))))).)))))))))))(((.((((((((.((((((((.((..((((((....((((...((((..((((((....(((((.((((((((........(((......)))..(((((((..((((((..(.(((..(((.....)))..))).)..)).))))..(((((((((.(((.......(((((((..((((((.((..(((.((((...)))).))).))))))))..(((((((((((((((...(((((((........(((((.((((((((....((((((((((.........(((.((((...((((......(((..(((((((.((((.....))))..........(((((....)))))....(((((.(((.(((.((((...))))(((..((((((..((.((((((....((((.((((............((((((((..((((..(.((((...)))).)..))))......(((((..((((......(((((..........)))))((((..(((((.........)).)))..)))).(((.((....)).)))...))))..)))))))))))))(((..((((((((((((...))))............((((((((...(((((((((...(((((..((((((....)))))).....((((((((......((.((((((.((((.(((.(((..((((.....))))))).))))))))))))))))))))))).........((.((((((((....(((.((((.....((((.(((((((.............((((...(((.....)))....))))....((((((((.(((((..((..(.((((...((((..((((...)))).)))).)))).)..))....))))).)))....))))))))))))))))...)))))))...)))))))))).((((((((.(((((..........((.....)).((((((((((.(((.....(((.(....))))..........((((((((((.....))))).).)))))))...)))))))))))))).).))))))))...(((((((((((..(((((.(((((((((......))))))))).)))))..(((((((.(((((..(((..(((((((((..((((.....))))....))).)))))).)))...(((.......)))(((.((((.(((((((......(((....((....)).(((((((((..(.(((((....((((........))))..))))).).)))))))))...((((((.((((.((...........)).)))).)).))))...((((((...)))).))...((((.............))))))))).))))))))).))))))))..)))))))(((((((..(((.(((...))))))..(((.((.((((......)))))))))..((((..(((...))).))))...))))))).(((((((((...(((((...((.(((((((...(((.((((((((..((((.....)))))))))..))).)))))))).))..)).))))).))))))))).....))))))))..))).....))))).)))))))))))))))))..))))))))..)))..)))).))))(((....)))(((((.(((..((((((((.(((((..(((((((((.....(((((...)))))....)))).))))).))))))))))))).)))(((((........((((.....((((.((((((.(((((((((.((((((...((.(((((.((((((.((((..((((....((..((((((((((((((((((((((((((.(((((.........(((((((((((((.((.....))..(((((((.....)))))))........((((.(((((((.((.(((((......((((..((((((((.......(((....(((....)))....)))........(((.(((((((((((((((((((.................)))))))...........(((((...))))).....((((((((((((..(((.((......)))))..))))))))...)))).((((..(((((((.((((.....(((..(((((......)))))...)))..)))).)(((((.....(((((((((((.(((.((((.(..(((((......(((((((((..((((.(((((..(((...)))))))).(((((((((((((((((((..........)).))).))))))).(((((((((((........(((.....((((((((((((((((..((((..(((((((((.......((((.((((((..((..(((.((..(((((.((((((...)))))).))..............((((((((((.((((((((.....)))))))).))).(((.(........).)))........(((((((.(((((((.................))))(((((((((..(((.((((..(((..(.((((((.((((.((.(((...))).)).)))).)).(((((((((........(((((((........(((((...........((.(((.((((......)))).)))..))........(((((((((.(((((.((((((.(((((..((((((((......)))))))).........((..((((...))))..)).(((((((.((((....((((..........)))))))).)))..))))........((((.....((((.(((((((.....))).....((((...((((.....)))).)))).....)))))))).)))).((((((((.(((.(((((((.(((...)))..).)).)))).)))....(((((...((....((.((((.(((..............)))...)))).))...)))))))........))))))))))))).).)))))...)))))))((((.......)))).))))))))))))........)))))))........))))))))).)))).)..))))))))))........((((...)))).(((.((((.........((((...((.(((((...)))))((((((....)))))).((((((((..(((((((((((((.....(........)....))))))...((((((((............)))))))).....((((((.....)))))).((((...))))....))))).))..))))).)))...))...)))).....(((((..(.(((((((((......((..(((.....((((......).))).)))..))))))))).)))..)))))..)))).))))))))))))..............(((.((.((.....)).)).))).......))).)))))))....................(((((((((..((....))......(((.(((.(.(((..................))).)))).)))..................))))))))).......)))))))))).)).))).))..))))))...))))...)))).)))))...))))...(((.......))).)))))).))))).....))))).....))).((((.(((....)))))))...)))))).)))))......((((.......))))........((((.....))))..................((((....))))........)))))))....(((.(((......)))))).((((((.............))))))(((.((((((.........((((..((((...........))))..))))......((((((((..((...........))..))))))))..))))))...)))))))..)).)))))))....)))))..).)))).)))..)))))..)))))).....))))).)).))))))))...)))))).......................(((((....)))))........))))))..)))...............(((........))).....(((((((.....(((((.((((((..................((((((((..(((.(((((((......(((.((...((((......)))))))))....))))......))))))..))))).)))...((((.....((((.................((.......((((........))))......)).......(((...)))...............))))......))))...))))))..)))))......))))))).((((.....)))).((.......))((((.......)))).......)).)))))).))))........)))))))))))))).)))).....(((((...)))))..))))))))))))).....((((((((((((....(((((((.(..((((((.((.(((((..((((((((.....(((((.((((.....))))(((((((((.((((..(((..........)))..)))...).))))))))).....(((((((......((((((((.(.((.....))).))))))))((.(((((((((.....((((..((((..(((((((((.((..(((.((....(((((((((.(((((((((((.((....((((.(((((.((...)).)))))..))))....))))...))))..))))))))).))))).(((....))).)).)))...))..)))))))))..))))..)))).....)))))).))).))...)))))))))))).......))))))))..))))).)).))))))..)))))))).....))).......(((((.....)))))...(((........))).......))))))))).((((....))))....))))))))))((((.........))))...))))))).........(((.((......)))))(((.......))).))))))))...............)))))).))))))))))..)))))).....)))))..))....)))))).)))).....((((...)))).........................)))))..))))))))))))))....)))))...)))))....))))))))))))))))).))).))).))))).)))))).)..))).....))))....)))).)))......((((((.....((((.....))))....))))))....))))))).......((...((.(((((((.....)))).))))).)).........)))....))))).))).)))))))))))).))))))).))))).)))..((((((((.(((((((...............((((...))))....((((..((((...........))))..))))............))))))).........((((....))))((((((((.((.((((..............)).)).)))))))))).......))).)))))........((((...........))))..))))))).......................(((((...(((...........((((((.........((..........)).........)))))).)))..))))).))).)))))))))........)))))))...((((((((..(((.(((((((......(((.(((..(((.....)))..))))))....))))......))))))..))))).))))))))))).)))))...))))))))))))))..))))))...((((..........))))............))))))))))...............((((((....((((....(((......)))........(((..(((........)))..)))......)))).....))))))...))))))))))).(((....)))....)))))..)))..)))))))))))..))))))))))))).......))))))))........(((((((.((...((((((((.....((((.((((((((((.(((((((.....)))))))........((((((.(((((..(((.....................(((.((.(((.(((((((..(.((((((..(((((.((((((.(.((.((((.((((.((((((((((.((........)).)).)))))))).((((((((.....(((.(((((..((((((((((((((((....(((..((((.(((((((.....((((((((((.............((.(((((((((((......((((..(((....)))....))))....(((((..(((...))).........((((((.....)))))).......)))))........)))))..................((((...((((.....))))..))))....((((.....))))..((((((.(((((...(((((((((.............)))..........................(((((....)))))..............))))))...)))))...............((((...))))........................)))))).....((((...)))))))))).)).........(((((...)))))..............((((........))))................((((((((.((.....))..........((((((...(((((((..(((..((((............))))..)))(((((..(((...(((((((..((.((((.........))))......(((((....)))))....(((((........)))))...(((........))).(((..((....((((.((..(((.((((((..((((......(((....)))........))))((....)).)))))).)))..))))))....))..))).............))..)))))))..)))...........)))))....))))))).....)))))).)))))))).)))))))(((.............)))....((......)).)))....)))))))))))..)))..)))).............)))))))..........)))))....))))).............((((.....))))(((((..........)))))))).....))))))))..........))))...)))).))).))))......((((.......))))..((.((.((((.....))))..))))........)).))))))))))).)..)))))))....))))).))).(((......)))....((((((.............)))))))).)..)))))))))))..((((..((((...........))))..))))......((((((((..((...........))..))))))))(((((((.((.((((..............)).)).)))))))))..............)))))))....)))))))....))))))))...))...)))))))..)))).)).........((((....))))......)))).))))).)..))))))..)).))))))))))...))))))))).))))...((((((..(((..(((((((.(((...........((((((.......))).))).......))).)))))))((((((..(((((.....(((((((((((..((((((.((((.((...((.((((.(((.(((((..............((((((((((.(((((.................((........))........((.((((.(((((((((((................(((((((((((((.((.(((((((((.(((..((..(...((..((((((((..(((((.(((..((((.((((...(((.((((....(((.(((......((((.(((((((.((((((((((.(((((...((((((........(((((.((((.....(((((...)))))(((.((.(((.(((((((((((((.....))))))((((.....))))..))))))).))))).))).))))...........))))).)))))).))))).).))).).)))))....)))..))))))))...((((((((...)))))).)).....)))))).)))))))..)))).)))).)))..)))))....))))))))..))...)..))..))).))).)))(((((.((...)).))))).....)))..)).))).))))))))))......((((..(((....)))....))))..(((((....(((...))).........((((((.....)))))).........))))).........(((((...(((.((((((..((((...((((.....))))..))))..(((((.....))))).(((((((((((...((((...(((((.(((((..((((....(((......))).))))((((.........))))...((((.(((.......))).)))).)))))....(((.......)))....(((..(((((......((((((.(((.(.((((..((....))..)))).).)))))))))...(((.............)))....)))))..)))......(((((((((.((((((((...((((....(((..(((((((..........(((((......((((((((((...((((..........(((.(((((.((((((.......((((..........((((((.......((((((...)))))))))))).....((.((((......)))).))..............((((((..........((..(((((....................)))))..)).)))))))))).......)))))).(((((((...........((((.....))))......((((..((((...........))))..))))............))))))).........((((....)))).(((((((.((.((((..............)).)).)))))))))(((((((((((.(((((....((.((((((((........((((...))))....((((((((((............((((.........))))...(((((((......((((.........((((.((.....)).((.(.((((..........(((((.(((..((...............((((((((..(((.(((((((......(((.(((..(((.....)))..))))))....))))......))))))..))))).)))....))..))).))))).........)))).).)).......((((..........)))).)))).......))))......))))))).(((.........)))..............((((((((........(((..(((........)))..)))..(((.(((((....(((((..((..((.((((((((((...(((...((((.((...(((.((((...(((((((((((...)))))........((((...........(((((((.((...((((((((.....((((.((((((((((.(((((((.....)))))))(((.....)))((.((((((((((((..(((..........)))..)))(((.((..(((((((..(.((((((((((.((((((((...(((.((((((.((((((...)))))).....(((((((((((.((((...(((((((((.(.(((..(((((..((((.(((((((..(((((.(((.((..((((((((((.((...)).)))))............((((((....((((.......((((..(((....)))....))))..(((((((..(((...))).........((((((.....)))))).......))))))).......))))))).)))...........((((...((((.....))))..))))..(((((..((((...............)))).....)))))........))))).)))))..))))).................(((((....)))))..............(((((....)))))................(((...)))......((((................))))......((((...))))....)))))))........((((((....((((............((((........))))..................(((.((.((.....)).)).)))))))..))))))....((((.(((..((((............))))..))).))))..........((((....)))).))))........((((....(((((....)))))....(((((........)))))...(((........))).((((.......))))........)))))))))))).))))))))))..))))..)))..))))))))....(((((((((.......((((..(((..........))).)))).......))))))).)).....((((.........))))...((((.(((.......))).)))).))))))...(((.......)))....(((....))).........)))..)))))))).))))..(((..((((((....)).))))..))).............((((...)))))))))).)..)))))))...(((((((((......(((((..(((......................)))......)))))..((((((.....(((.......)))(((((..........))))).......(((..((((.((......))))))...)))..)))))).......((((.......))))..((.((.((((.....))))..))))............((((....)))).............))))))))).(((......)))....((((((.............)))))).........)).)))((((.....))))......((((..((((...........))))..))))....))))))))).))............((((....))))((((((((.((.((((..............)).)).)))))))))).............)))))))....)))))))....))))))))...))...)))))))..................(((......))).........(((((....)))))))))..(((((.(((((......(((....)))............(((((....)))))..............(((((....)))))...............((((...))))........................(((((((...((((((.(((........)))............))))))...)))))))...........((((.....))))................((((((((((((((.................((((...........))))..............((((((.....)))))).......((.((((.......)))))).....(((((((.....(((((((.((...(((((..........)))))....))))))))).....((((((.(((((((.((....)).)))))))....))))))...(((((.........(((((.((((.............)))).))))).........)))))..........(((...))).(((((((((.............))))))))).............)))))))(((((((.(((((((((..((...(((.(((((((.(((((.(..(((((...........)))))...(((((((........................((((((....)))))).....((((((.......(((((..((((((..((.......((.(((.......)))))..........((((((((.......)))))))).....))..)))))).))))).))))))............)))))))............(((((((((((((((...(((...))).........((((((((.(((((((..(((...(.(..((((..(((((((...((((.((((((..((((.((((((((((....))))((((....)))).....((..(((((....)))))..))((((....((((..((((.((((((.((.(((...(((((.((((((((((((.((((...)))).)))).)))...........)))))))))).......))))))))))).))((((..((.((((((((((....(((((((((..((((((....))).)))....(((((..(((((...((((((....(((((((((..(((....(((((.(((((((....((((((((((((.((((............))))...........(((((.((((...((((((.((.((.(((((...))))))).))..))))))...))))))...)))........)))).))))))))....)).)))..)))))))..)))..)))..((((((((((((((((....)))(((.(((.((((...)))).))).)))........((((((.(((((...((((((((((.....)))))...................))))).((((((...))))))...........(((((....)))))((((.((.(((........))))).))))..))))).))))))....)))).))))))))).(((((....((((((((((.((((......(((((..........))))))))).))))))..(((((.....)))))....................(((((.....)))))))))..)))))..))))))....))))))..)).)))...)))))((((((((...........(((........)))......(((((((((.......))).))))))(((((((((..........))).))))))....)))))))))).)))))))..)))).)))))).))..))))))..))))....))))..)))))).))))...((((....(((....)))...)))).....)))))))))).)))))))..))))..))))).)))))))))))))))))))))).((....))...))))).)))............).))))))))))))))).))))))).))))(((.....)))((((...))))..............)))))))))).))))))).))))......))))).)))))...))))))..)))).)))((((.(((......))).))))...))...))))..)))...)))))).....)))).))....))..)))))....))))).))).........))))))))....(((.(((((...(((((((((((....(((((((...(.((..((......))..))).)))))))......((((((....(((((..((.(((....)))))..)))))..)))))).......)))))).)))))...))))).)))..)))))))))).........((((((.(((..((((..((((.((((((((..((.(((((....)))))))..))..))))))))))))))))).))))))...........((((....)))).((((.......))))))))))))))))))).)).))))))))).........((..(((((......)).)))..)))))))...)))..........)))).....))..))))))))......)))))....))))))))))..((((((.((.......((((......)))))).))))))..))))..))))))))..).)))))))).....((....))))))).)))).)).)))))))))))))))..)))..(((...........)))......)))))..)))))))).)))..)))))).....)))))...)).)))))))).))))).)))..)))).))......)).)))).))))))..))).))))).))).....)))))..)).).)))(((.(((((.((.((((((((....)))))))).....(((.(((((((.((.((...((((......)))).)))).)))))))...)))....(((((....(.(((...))).)....))))))))))))...))))))..))))))...))))))))..))))))).)))).....)).))))))...)))..((((....))))..))).....))).)))))).......))))))))))))))).))))))))))...))))))))))).))))((.....)).......((((((...))))))....)))))))))).))))))..((((((.((((..((((...((((((((.((.....)).))))).))).))).)..))))))))))((((((((((((.....((((..(((..(.(((...))).)..)))......((.(((((((((((.((.(((........))))).)).)))))))))))......((((((.((((......))))))))))((((.((((((((..(((((..((((.(((..((((.(..........).)))).)))))))))))).))).))))))))))))).....)))))))))))).((((.(((..((((((((.(((((............))))))))))....)))..))).....)))).......))))..))))).....
Thermodynamic Ensemble Prediction
.(({(((,{((({{({,(,,,((({{{{...,,,....(((((((.((........))))))))),{{(((((({{{((((((,({((,,,,{|||}||||}|||..||}}}|,||({((...|||||,|}}.,||||,...|,|||||}|,|||}||,,,((((.((((((.(({....}))..)))))).}.}||||,|(((,....))}}}|,,||}||,||||||}.{{{(,{{({,,,,.,|||{{(({((({,{{(...,,(({{{{,,.{((((((({({((((({,{((((({(,..........,,{,,..,,({{(.,,.})))....,,..((((((((({{(((((.(((,((,,...||,|||.(((,,{,,((((((.(((.((((..(((......)))..))))))).))))))....)))..))),)}}}.})))))),}}..})))}}}}|||({(((((((((((((((....,{{,.(((((((......(((((.(.(((((({((((.....,,||{{,,{||||.(((((((((({.,(((.((((.,,.......,((((((({(,....)))))))))....(((((((..((.{.(({((((...({.((((((.((({..........((......(((.{((((((.((((((((,({,....((((....)))).....{{{.{{{,.,((........((((((((.........)))))))),.....))}))).)))({((((({{{.((.(,,((((((((..({(.{((..{((((....)))))..)))})),.((((((((,,.,{({,.,,|{,{{{,,{,|||||.((,({(((((((((({,.(((.((((,((...((((.(.((.(((((.((....)).)))))))).)))).((((,(((.(((((..(((.(((((...(((((.....)))))...))).)).))))))))))).)))).|.{({...(,((((({({((((((.(((.((.((..((((...........))))..)).)).))}.))))))....,,,.||.}}})),)}}}...}}}))).))).)},})))))))))).,,...((((((..(((((((((((((.....))),((((((((((.{.......({{{{{{((((((({(((({{{|||||((((,,,,||,,....||||||}||.|...,,}|,.)))}}},.,,............{((((...))))).,))).}}))}||||...|||||{{(((({,(.{({{{{(,|{{{{(|({{{{.....)))))|||||||.,.{,{({,{{{,.{((({{{(({.{{{......,.(((((((((((((.((,(((((((.....)))}}))))}.,.,,)}}}..})))))))),||{{{{(({{{({,,(({{({{{{{{(({,,..,,...{((((.,,...|||}|..||||,.(((((((.(((,(,,...},|||.}}}|}}}...}})||,{|||.((((((...............)))))).||||||.,,,,,))))))...,,,,..{{{{{{..{{{{..{||,..,,..,,))),)))).,)))))),{|{{((({|{{(((((,,{.|||||||{{({{,{...{({{(((({,,{{{,(((((((((((((.....((((((.((.(({((((((({.(((.........))).,..))))))).),}).))..))))))..)))))))(((((((({,,{(((,{{.(((({{|||......,||}})))..{((({(({((.((,...})))))..}}}}}|,((((,.,,.,{.{,||},|(,(((({{..,{{{..,|||||,,(((((,(||{.|{||||.||..,|,...,..||||||,.....)))))}...},,.,,,........,..}},.,|||.,{(({{{,,,,.||}}}}})},))))...})),)|||,|{{(({,(,((.{({{{,|,||||{||||||{...|||{.,|,|{|||||{{{..,))))))}}}},,,|}|,{{||||||}}|||||{{||{....,,,,,,)))),.})))},..,))}}}}|{((((((....})))))||,||{|||||{||,,,,,|{,{(((((((.....)))))).)),}}.}|||||,}},|||..,||{{{{||{|..{|{||,,,..|||||||(|((((,.,(({,......((((((((....)))))))),||||||||||}.||||,.}..},}))))..)}})}}))}}||||{||||.|||||.,|.||.||||((({(((((({{(((..{{(((({..(({,{(|(({{((((.{{{|{{.{{{,.....)))|}|}}|||({|(|,.{||.{{.||.)}})),})))||{....))),||,|||||{|..|||||{{(((((.,...((,(((({.,,,,(({(({{(,({((((...|}|}.,,,.|{||||||..(({((((..,(({{{(,(((((({(({,.{{.((((,({(((((((({..,,,,(,((,(((.{((((,((((((.....,.((((.........)))){}{(.((((.....))))..}}.}....(((((....)))))...{(((((.((((((({{({(.,,||{|..|||{(({{,..|||((((((((((((((((((({..{((,,.....))))))}..({((..(,(((.....}}}})}})}}),,...{({(((...,(({...(((((((..........))))))).....}}}...,,|...}))))}.))))))).))))).)))){((({{..{{{,,....))),.....(((((((....)))))))..((((((.((((....,,((((.......{((,((((((,(,((((((((((((((..,,.)))}}},{({,.{,({...,||||,||}|...((((.....))}}...((((((((,({(((((((,.{((((.((,{,...}).)).))))...}..))))))).(((((((((((((((((((((.(((((((((({(((.{{.,.{{{{...{{{.,.,.))),...)))),}..((.((((((.(((,(..((((((({(,,,(((,..((({,,.}}}}.}))}.)}}}{(((.((....)).)))}(((,,((((...(((..((......}}....))).)))))))).,,,}...})))))..}.})).))))))}},.....((((((((((.(((.....(({.{....}}}}..,.......(((({(((((,....})))),).)))))))...)))))))))).,})))).)))))))))))))))}{{((((({((((.(((((((((......))))))))).)}))),...))))).},.})))).))))}}}}))))..((((.....,,,,.,,|,,,.}|}(((((((((((((.......((((.,.,||}}....|||,.........{{{({,...{{.((((((((((,,{(((((...,({((((,,{((.,(({.{{{......)))))),.,}}})))))},{{((......|}}},.,,,.,{,(({((((((((,.(((((((((....((((.((..((........(((((((((((((..((((((.....((((....))))..({((,((,,{(({,{,{...}})},,..}}))))))))..,|({{(,(((..(((....))}))}.,)))).,.))))))...)).)))..))))))))........,,.{,({{((,..(((.((((((((..((((.....)))))))))..))).)))}}}}}.|((,(({{({(((.((({{(((,...}}}|,.,,,..)),,,...,,,,,......},,||||}..,,,,.})}}.)}}}.)))))))).}}),))}.,,..(((((.((((...{({(((((,{{(({,,((((({(((,....(((((...)))))..|,}}}},,}|||,||}||||}}}}}}.}..{{{,,.....,{{{(({,,.,.((((,{{{{{{.||||||(((.((((((...((.(((((.((((((.((((..((((....{{..((((((((((((((((((((((((((.(((((,({{...{.(((((((((((((.{,.....}}..{((((({.,,,.))))}))........{(((.(({((({{{{.{((((.{....,(((,,((({((((.......|||}.,,|||,,..)))...,))},.......((({(.,(((((.((((((((((.{,..........,}..)))))),...........(((((...))))).....((((((((((((..(((.((......)))))..))))))))...)))),))).)))))..||,|}}......(((..(((({......)))))...)))..||{({|.{{{|,|,{,(((((((({((,(((,{.{(((((((.,.....}}}}||,||(({{,,,,.||||,..,,,..,|||,{((({((((({{(((((({,(((({{,,{{{,..||.,,,.,,||||{,(((({{({{{,........|||..,,}|||||{(((((((({(..((((..(((((({((,,.....(((({((((((.,((..,,((({(,((((({((((({...}}}|||,||........{(({{,{(((({,{{{.((((((((.....)))))))){||},((({........,|.,..,,......(((((((,({{{(((.................||||((({{{(((..{({,({(({,,{{..,.{{{||{|||||.{|,|||}}.,}}.||{||||.||.{((((((((,.......(({((((,.{{,,,,({{{{...........((.(((.((((......)))).)))..))........((({{{{{{,(((((.({{{{{.|||{{,.{(((((((......)))))))}.......{.{{,,((({...})))..),.|||||||,((((....((((..........)))))))).))),,))}}........{|||.....||{{.(((((((,....}}|...,.((((...((((.....)))).)))).....)))))))).)))}.,,{{{,{|.|||.|((((({.{{{...}))..).)),,})).))),}.{(((({.,.{,....{{.((((,{((.,............{||{..|||,....}})))))}}....,..|||||}||||}}}}.|,|||}},..}|||}..,{{{...,,,,||||}}}}|||}|||||..|||...}}}}}|}........)|||||}|||||||....||{|||||||,.....,,||||,,.|}))}(((,(({{...,,,{..{,||}..{{.,{{{(,,{||||,((((((....)))))).((((((((..(((((((((((((..,..{........}.,..))))))...((((((((............)))))))),....((((((.....)))))).{(((...))))....))))).))..))))).)))...}}..,||||.....{||||..|.|||||{{{{.......(,.{,,.....,,{.......}.,}}||||..||))))})}.)},..}})))..}}|}.},}})))}}}}},.............{{(,{{.{{.....)),)}.}}}.......))).}}}||}}....}}...,,,,,..,...|||||||||..||..,,)),,,,,}{|{,|||.|.||{,,................|||.,,)),}},.........,,,,,,,.,|||||(((|.,....,||||,,|||.....,,,.,}..},},,,...)))}...,}))}})}}},,.}}}}...{{,.......))).}}}}}}.}}}))....,)))}}....{||,.((((.(((....)))))))...)))}})}))))}......{,,({{.....,)))...,....((((.....)))).................,((((....))))........,,.,,))}}}})||.|||}}},..|||||,.((((((...................}}}}},|..)}|}}.....((((..((((...........))))..))))......|{((((((|.||...........}|,.}))))))|{{{{||||{{.||||,.......,,,,,,)).}}.))))}})})||.......|}}}}||}.,,,,...||||.,,..,.}}..))}}...||}},,...............,,......(((({....)))))......}}))}})).}}}||,,,|||||....||(((.,......}},.....(((((((.....(((((.((((((..................((((((((..(((.((({{((.,....(((.((...((((......)))))))))....)))).}....))))))..)))))},)}...((((....,((({....,,,........,.{{.......((((........))))......},...,...|{|.....,..,............)}}}......))}}...))))))..)))))......))))))).(({{.....})))..,.......,}{{{{.......)|||....,,,||.}}}}}},|||||{,...|,||||},}}||}|||.}}}|,....(((((...)))))..}}}}}}))}}}}}........(((((,(((...,(((((((.(..((((((.((.(((((..((((((((.....(((({.((((.....))))(((((((((,{(((..(((..........)))..))).,.|.))))))))).....(((((((...,,.((((((((.(.(,,....)))})))))))){(.(((((((((.....((((..((((..(((((((((.{{..(((,((....((((({(((,((((({{,(((,(({{,,((((.(((((.({...}).)))))..)}}}....}})),},}}))},)))},}})),))}},,|||...,)}).)}.))),,,))},)))))))))..))))..)))).....)))))),})).))...)))))))))))).......))))))))..))))}.)).))))))..}))))))).....))}..}}}}}(((((.....)))))...{{(,,,|||{{|||{,,,...|},||||||.,|||||,,,.}||...}}}|||}}},((((.........))))...}}}|}|}.........(((.((.....,)))))(((.......))).}}}||}},..,|,......,{,{|}}|||.|,||||}}||..}}))}},,,,.)})))}})),}..})))}}.}}}......{{{|...})))....,},......,,,,.,,}}},})))))))}.}|||}}}.}},.....)))}},...}}}}.))))),..}}.}))}..}}}}}}}}}....,,,.......}|}{{{||..........,})))}},.........((((,({....,,||}}}}.,)))}}}}))))}}......{,,(,,.....})))..{{.{({((((.....)))).))},,...........|((({||{|||,|..{||{{{|{{{......)))}.|||.||||||......({((((.(((((((.........,,,....,,,...)))}....((((..((((...........))))..))))............))))))))))},}}..((((....))))((((((({{((.((((..............)).)).))))))))))...,||||,....|{||||{....(((({{{..,.{{{{||||...||.|,|{|||||...,,,,...........|||,.........,,}}...|({((((.....,|{|{|,....,..{{||.,......))))},,.|||{{{{.,{||{{{{{..,{(((....,.............({((((,,..,,,}|||,||{.,.,..(((.(({..(((.....)}),,))))))....|}}}.,....|}|||}..}}}|||,.,..,||||..,,||{|,....}}},.....,,|,}}},.....||||......,...}}}}.,,.,...,,..,|||.....,,,},.||.{{{,,..,.,||}}}.,||.....,,,,,}||)|})),.....))))),,.(({{.....})))..,.....,,,(((((...,,.{({{,.,,,,..||.....{{{...,)}}.......((.......}}...,.}..,}}|||||...))))),,......)))))..........))))))}.}}...))}))))}..,..})}).)))))|||||.(((((((.....))))))){{{..{{{(({,.,.|}})))}))),..,,,.................}}))})))))))))))..}.}))))|..||}||{(((((({.(.(,{,.,.))}|)))}}}}),|{||{|,|....,|,|||.||||||,,.||||||||..{{,{{|,|{{{{..{{{{{{({{|||,,||,,,.{{|.||.|||({((((({.{,.,.||.}}}}}......,.....{((({(,,((((((.......((((..(((....)))....))))....(((((..(((...))).........((((((.....)))))).......)))))......)))))),)}}.}}}...........{(((...{(((.....))))..)))}....((({.....}}}}..,,,,...(((((....}))))||{.......,,}}}.))),,..}}}}}..,|.............(((((....)))))..............(((((....))))).,.............((({...))))......||,,,||,.,,,.....,,})))......((({...)))).,..}}}}}}}.......,{{||}},},,})}}},..........{{{(,,,.....))))......,,,,,.,,..{{((({((.{{.....|}.},.,,,,.,||||||,..,,||||{.}|||,..(((,...........))))..)))})))},,||,...{{(((({..,{.{|{{.........))))......(((((....))))).,,.|||||.,,,.|||||,.,..,}))),,..,,.,,}.|||}.((....,,||{{{,|{{{,||{||{..{{({.....,{|{....))),.......},))}|...})}}))))}}.},,.,))))),.,,}))..)))}...........,)),.)))))))..)}),},,||.||,,}}}}}}..})))))))}..,,)))),,.}})))))).}}|||,}|}},,.,,},......{{{...,||,,...,||,,,,....||||,,,,{{||||},.)))))),}}}}}}}.,|,||||||,.,,.,},,,.|||||...,|||||,,}},,,,,....((((.....))))(((((..........)))))|,,.....||||||||..........|||||},{|||||||{(||,......{,,(,,.....})))..,{.{{.((((.....))))..}},,........,,.((((({(((((.{..{{(({((....((({{.(((.(((......)))....((((((.............)))))),,.,..{{{|{((({{{..((((..((((...........))))..))))......{(((((((,.((...........}}..)))))))|(((((({{((.((((..............)).)).)))))))))}.............(((((((....(((((({..,.((((((((...({.,.{((((((..................((((....}))).........((((((.........{{.........,}}.,......,)))))}.(((((((..{{{(((({..{(((({{{.(((...........({((((,,..,,,}|||.....,.,..|}|.||}}}|||{......)))}.,,,}.}.}})}).},,,,}}}|||,,}}}}}|,,,,,.|||{.,{{{(((.....))))......}}}}}}}.....((((........))))...,..|,........||........},.,,.{{{,,..}.,,,}}}.,||.....}},,,))}),)))).....))))))).(({{.....})))........,,,(((((......(((((..{|...||......||,...||......{{((,.{....|,....,}..,,}))))},,})},))))).....)))))..........))))))).))..,)))))))).,,..)))).)))))))))).(((((((.....))))))).....,,.))))},}))))),|)||,..,,{..........},,..))).)).))).)))))))..).)))))),.))))){(((({{{.{.{,||.,.))}}}|||}}}){{|||{{|,,{,.,|.,||{|}||||,,.||||||||..{,{{|}.|||||,,||||}|||||}|||||..{{|||{{{,|||||,||||{.{,.,.)).)))}},....,,....{||}|}||.,,||||}}.,,}}})|,..,)}},))))},,,}}}})))).)}}}.}}))}}},}},,},,}}...,,{(((|..,.|||||{|||,......||{|,,,,...}})),,....,...}}))),,,})}))))),))}}.,)))),,||,,...,||))),,,,))})).,,}})})))})))).)))}}.,,,))}))).).)))))))))).)).}}}..|||....|||{.........))))...,((({(,,.......,||{,||.....,)))}}(((.......))).}}}}},.....)))))}..(((((,{(((.{.((((..((....))..)))).).)))))))))}}})))).,,........((({...})))..,}.))}))})).......,,..||||||,,..|{||{...|||.......}.....,........))},....,}}}....)},.........,,,,,}}}})}}.,}},}}....,,,,.,}|||........,..(((({{.......{{||||.,,))))))})}))),))})))}}},,.},,,)))).)))))).,,,......,)))}}}..............(((({....||.,..,,|||||,.,.)))),}|||,||{.,|,||)))}}}.{{((((.(((((((.....,.....{{{,.....||||......((((..{{{{...........))))..}}))........,,,,||}}}|}}}},.....{{{{..,,))))(((((((||({.((((..............)).)).)))))))))),........,,,,|||.,,.....((((.......,,,.||||...||,..,.,,,|,...,,,,..........,|||,.........,,,},,.,||||||,,}},.,},|,,.......{(((.,......)))),},.)))}}|}}},})))})|....(({..,.},,......,,,,,|{((((,,..||,}||||,|||||||.|||||,|,,{|{,....,,)}}))))))},..(((((,({..{(((((..,||||,,...,}})))....||{|,,,,.)))}...,,|,||||},.,...||||},....,,..,}}|.||||,,......|||...,,,,,|,,||,|{,,,}}|,|||||}}}||..........||{|||||,.....|||||..,((,,.....,)))..}}}......{((((......,||||.,,,,,.||.,,..(({...,|}}.....,.((.......}}...,,}..}}}|||||...)))))||,,,.}}))}}}|......,,,|||||||,,,..||||||||,|..,,||||.||}||||{,|{(((((((.....|||||,|(((..,{{|||}...,}}|||||||,..,,{.,..............,}))),|||||}}||||||||||||||{..}}}}|||||{{|.|,|}}}.},))}})))),,})||,||{{{{{{{.{(((((((,,(((,.,((,{((((,.(((((((((((({.,((,,{(({{{{{.(((((.(((.((..((((((((((.({...}).)))))....,|,.....||||{{|,,.||||,,...,.||{{..(({..,,))}....}}}}..{{{{{{{..|||}..))),..,,,...||{|((|..,.}|||||,{{....}}}||||.......)))),,,.,,}...,..,....,|||},,|{||...,,)))}..))),..{|||{,.||||,},,..,,,,...,,))))..}}}))})).....,,.))))).)))}),.)))))..})}}),,.,,.,,.,}))))),,}).)))},.,,,,.......(((((....))))).,,..........,,.(({...})),,....,,,...,,,..,}}}.,.,.,))),.,,..|||,...))}}.,............,....||||||....||||............,,,(,,,.....))))..................|||,{|.{{.....|}.}}.}},},||,|||}}||{.||(((||((|.,{((({|,,|||.,,,,||||.||,},,|||,{|||,||||((((....)))),|,.........|||{||{.{{||}}||,|||}}....||||.......(((((.....))))).,,,{,,{{|,||||.......))))},,,..},}||{||{|,||||{{,,||((||...}}}}|.,.....(((((.....))))).,,{||,,,}.{|||,|{,.....}}}}}})}}.,)))}}},.}}|},..,..||{....|||,......,,,)))),..,|||}||,.,,,,,,)))}))))..},))),..(((.......)))....|||....})),,,,.}}}..,,,,),))))))},,)),..{|,...}})))))}}|||}|||{{||||.}}}},}....((((...))))....,,,....}}||||||,|,,||||||||..,||||....|||},}|,{||,}}.}}}}},.,{,||}}},..,|||,,,,||..........}}}}}}}}})}}|||||}}.,.}}}}}))))|{{.....||,..(((({(,....{{||}}},.}})),..})))))}.}}}}}}}}}}}}.,,,}))).|||}|,.{{{{.....))))..,..............|((((....})))....}}}}}}.,.)}}}})))}}|||.},.}})))))}}||((((.(((((((....................,.....{{{{.....)))).....,((((..{{{{..,.,......))))..}}}}..,,,},...,.))))))))))),,,..((((....)))){(((((({{((.((((..............)).)).)))))))))|{{{{{{{{{{.{{{{{.,,....{(((({{{........||||.,,))},....{{{{{{{(((,...........(((......}}}.....,,,.(((((...{|||||(({..,.......|,,||}....(((....}))............(((((....)))))..............|||||,...))))).(({{.......{{{((((...,|,,.........,{{{{{{((((....(((((((...((((((.(((........)))............))))))...)))))))...........((((.....))))..............{((((((((({......{,|,.....,,....{((((...........))))......,.,.,...{,{||||..{,|||||,...,,,.({{((((.......||||,........,|,,|,....(((((((.((...(((((..........)))))....))))))))).....((((((.(((((({.((....)).}))))))....))))))...(((,,..}}}..,.(((((.((((.............)))).))))).}.......}||}}.....,||{,,,({{(((((,,,{{{{{(,....{{{{{....||,((((((,,,{..(({....|||{|}|{|||,,.{({{{{,||.....,{(((.(((,..((((.{.....}.))))...,,.,,,.)))))......((((((((((.((....{{{{{(,.,..((((((....))))))....,))).))}.......))..)))))))))}{{{......})}..},..},)).))}})).........||||||{},..}}})))))))|(((((((.,,,....{(((({,,,|.,...,,,,..{{{{{{{{|,|,,||..{{...{(((,(({((((((((,(,((({.{|}},{{,.....((((((((.(((((((..(((...(.(..((((..(((((((...((((.((((({,(((({.(((((.((((....))))((((....)))).....((..(((((....)))))..}}(({.....,}}}.((((..((((((.((.(((...(((((.(((((((({(((.((((...)))).)))}{|,...}}..},}..)))))))))).......))))))))))).)))).......((((((((((..,.(((((((((..((((((....))).))}....(((((..{((((...((((((....((((((.,...,,,....(((((((.,,,{{....||||{|||{{{{.((,(,....}}}|.{{{|||,{{........{{{{{,(({{...(({{,,,|{,|..|||||}.{||||||,.||.{|}|||}...|||||,,,.}||,.......)))),))))}))},{,,|||,|}.,||}|}|),,|||{((((,.((((((((((((({,,{.,.{{{({(.(((.((((...)))).)}}.}}},|,.....((((((.(((({...((((((((((.....))))).................,.))))).((((((...))))))...........{||{{,.,,})))){{({,({.{{{.....,..))))).))))..})))).))))))....)))).))))))))).|,})))}..((..((((((.((((......(((((..........))))))))).))))))}}(((((.....))))),..,.,}..,,}}}}},...(((((.....))))).,,,},)))))}}))))))....))))))..)).))}...)))))((((((((...........{(({(({...,|}}.....,(((((({,({((....)))})))))}{|{{{{{||,.|}},...|))).)),)))..}.)))))))))).))))))),.)))).))))))...,.((((({.,({({,....,,,.,},,}},}|||....)))}},,.|||}}.,))}))))).}.}))))))))))))).)))))))..))))..)}))).)))))))))))))))}}|||||.{{....)),|||||||,..|{|||||.{{..{|||{.||.||||....{{{(((,(({{{{{{,||,|.{((((,,,...|||...)),,....})))),),)).))))))}),)),...))..)})))).)))})))}.)))))}))))))))(((((({,{,..{{.{((((((((,{,{{,,},|||.}}|..,..|||{|({,,{{{{{.||||,,.{{,...||,}}..||||..})))}}}}.)}..,))).|{||||,||}|||||}}|(({(({(((((..,,,((({,,.,,|.||.}|,.}}})})).})))}))))))).}}.,,,|||||}}..|||||}}||.||(,{,.||,,,..,,,,,},})))),....,)})))),,.}},,,.}})),,,.,,,.,)))))})))).........((((((.(({..((((..((((.((((((((..((.(((((....)))))))..))..))))))))))))))))).))))))............,,|}}},))}))|..}}))}....}}}}))))}})))))))),)),)))}))))}}..,,{{{.{{,,(((((......)}.))),|)},.)}},})))}..}},...)))))),...,}}..))))))}}..,,..}})))....}))))))))},}||||||,||,,.....|||{...,..))))})||}}}}))})))}.)))))))})..},))))))}}.,,,,))......|||}}.}))).}}|}})})))))|((({.......}))))........,,),,...{|}||||{,}|||||}}|||{(.({{((({.....,,||||||||.|}|||{|||.}))}}||||,{,....,..,.((({{(,(((,,,,|}|,{((({,..,,{|||,.}}}}}},,,||||}||{|||}.,|||,||}|{{|||||,,,,))))))))},...|||}|||||{|.|||{{{{,{{,{......)))),}||),))))))|,|{|}},,,,|)))}.}}}},|||}..})).,..,||,{{{.,.(((((((((.,.....))))))))).},))},}}{|,,.|,||||,,,,{,,,,,,,,}}}}|},.....)))))}}))),))))))}}}}})}..}}}}.....,,}|))))}}|.,,}}))))})}..,||||,}}}}}}}),,..}})})},,,},||,,,.||{({{(((,,.}}))))}...,,)))},))),})))))},((((({,((((..{,((,,,((((((((.((.....)).))))).))).)))}).,)))))))))}}}}}}))|)}})}.,,,)})}}.}}|}}}.|||}}}|,,}}},}},,,,,..{{.((((((((({{.,{.{{{|,.,,...)))}),}),)))))))))))..}}..{(((((.((((......)))))))))}((((.((((((((..(((((..((((.{(({{(((({(....}}}.}.),)))}.)})))))))))).))).)))))))))||||{,{{,..||||{|}||{,|}..,)))).|||,{(((,((((,..,,........)))))))))|||,,|,,,,||}|||}|,,.......,)}}))).)),))},},.

Transcripts

ID Sequence Length GC content
ACCCGGCCCGGCUCCCUCCCUGCCCGUCCCCGUCCCCCCACCCGUGCCA… 17911 nt 0.6454
Summary

This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]

Forensic Context

A review of forensic proteomics literature notes that the MUC5B is found in vaginal fluid, where it serves as a protein marker for body fluid identification [Alex et al. DOI:10.1016/j.scijus.2025.101320].