| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCAAUUACAGUAUUUCCUAUUCCUAAAAGAAUCUAGUAGGAAGGCUA… | 2541 nt | 0.4054 | |
| ACUGUUCCACUACUCAUCAAGCACAUAAGUUACUCAUUGAGAACCUCUG… | 2480 nt | 0.4073 | |
| CUCUUCUUUUGCUUCUAGUUACCAUCCUCAAAGGAUUGGCUAAAAGCAA… | 2363 nt | 0.4088 |
This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. This antimicrobial protein has antibacterial and antifungal activity. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Oct 2014]
A study in humans demonstrated that the MUC7 mRNA marker, targeted via two coding region single nucleotide polymorphisms (cSNPs), was successfully detected in saliva samples using a custom multiplex PCR and Illumina MiSeq sequencing, where saliva samples exhibited the highest read counts for this transcript [Trnka et al. DOI:10.1016/J.Fsigen.2026.103455]. In a separate collaborative exercise, the MUC7 was mentioned in the introduction/discussion as a saliva identification marker but was not experimentally studied within that specific protocol [Haas et al. DOI:10.1016/j.fsigen.2013.09.009]. A study in humans developed a multiplex RT-PCR system for body fluid identification, where the biomarker MUC7 was evaluated as a saliva-specific mRNA marker [Tomoko Akutsu et al. DOI:10.1016/j.legalmed.2022.102087]. Another study in the Chinese Han population also included the biomarker as a saliva-specific marker in its multiplex mRNA profiling system, where it was amplified only in saliva samples [Song et al. DOI:10.1016/j.jflm.2015.08.006].