| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACAGGAAGGAGCCGGUCCAGGCUCCGGGGGCUGGGAAAGGGCGCGUCU… | 2367 nt | 0.6063 | |
| GACAGGAAGGAGCCGGUCCAGGCUCCGGGGGCUGGGAAAGGGCGCGUCU… | 2364 nt | 0.6062 |
This gene encodes a structure-specific endonuclease which belongs to the XPF/MUS81 endonuclease family and plays a critical role in the resolution of recombination intermediates during DNA repair after inter-strand cross-links, replication fork collapse, and DNA double-strand breaks. The encoded protein associates with one of two closely related essential meiotic endonuclease proteins (EME1 or EME2) to form a complex that processes DNA secondary structures. It contains an N-terminal DEAH helicase domain, an excision repair cross complementation group 4 (ERCC4) endonuclease domain, and two tandem C-terminal helix-hairpin-helix domains. Mice with a homozygous knockout of the orthologous gene have significant meiotic defects including the failure to repair a subset of DNA double strand breaks. [provided by RefSeq, Jun 2017] CIViC Summary for MUS81 Gene
A study in mice demonstrated that the MUS81 gene was upregulated in the ileum of methamphetamine-treated animals compared to controls, and its genomic location is near SNPs associated with inflammatory bowel disease [Sun et al. DOI:10.21037/Atm-20-7741].