Basic Information

Symbol
MX2
RNA class
mRNA
Alias
MX Dynamin Like GTPase 2 MXB Interferon-Regulated Resistance GTP-Binding Protein MXB Interferon-Induced GTP-Binding Protein Mx2 Second Interferon-Induced Protein P78 Myxovirus Resistance Protein 2 P78-Related Protein Interferon-Regulated Resistance GTP-Binding Protein MxB Myxovirus (Influenza) Resistance 2, Homolog Of Murine Myxovirus (Influenza Virus) Resistance 2 (Mouse) Myxovirus (Influenza Virus) Resistance 2
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden death from CNS diseases

MANE select

Transcript ID
NM_002463.2
Sequence length
3408.0 nt
GC content
0.4930

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1096.10 kcal/mol
Thermodynamic ensemble
Free energy: -1158.80 kcal/mol
Frequency: 0.0000
Diversity: 785.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((...((((((.((.((.....)).))))))))....((((((.((((((...(((((..............)))))...((((((((.....)))))....)))......))))))))).)))(((((((((.....)))))))))(((((((..((((..((((((.(((.....((((((....))....(((....)))...(((....))).(((((((......(((....((((((((((((((((((..(..(...((((.....)))))..)..))))))).....(((((((((.((((..((((...(((((..........((((......))))........)))))..((((.(((.(((..((((((..((....))....))))..))..)))..))).))))))))..)))).(((((.......)))))(((.((((((((((.(((((((.((((((((......))))))))(((((((((...((.((((.(((((((((..(((.(.((((((((((.......))).))))))).).)))...(((......)))(((((((((((..(((((.((((..((((((..(((....))))))).)).)))).)).)))..)))..(((............)))...(((..(((.((((.(((((....))))).((((.(((....))))))).((((.(((((....(((((....))))))))))..)))).......)))).)))..))).))).))))).(((((.(.....))))))((((....)))).(((((..(((.((((.((..((((.(((.((.(((..((((....(((((((.(((.((((((((((((......).)))....)))))))).)))((.....)).((((((.(((((((..(((....)))..))......(((((.(((((.(((............))).)))))..))))).....((((.....))))((((((........)))))).)))))....))))))..)))))))....))))(((((((((..(..........)..)))).))(((((.(((((......(((((((......)))))))..........((((((....(.((((((((..(.((((((((((.(((((..((..(((((((............))).........................((((((.(((((.(.....).))))).)).))))..))))..)).))))).....(((((....))))))))))))..))))..)))))))).)....))))))((((((((.((((.........(((((((.....)))))))......))))))))))))(((((........((((((((((((...(((((......((((((......))))))......((((((.(((....)))......))))))............................((((((((((..........((((.((.(((..((...(((.(((..((((........))))))).)))...)).))).)).))))..((((...))))((((((..((.....))..))))))((((((..((((.....))))....)))))).......(.(((((((....))))))).)))))))))))...........(.(((((((((..((((...........(((.....)))......((((((((((...(((...(((((........)))))..))).)))))))))).............))))..))))))))).)..((((....((((..........))))..))))..(((((.......))))).))))))))))))))))).........)))))(((((((.........(((.(((((((........))))))).)))..))))))).......))))))))))......)))...........(((((...))))).........)))))))).))))..)).)))).))))))))......((((((...........))))))..(((((...)))))(((((((.(((((.((..(((.......)))..)))).........)))))))))))))))))))......)))).))..)))))))))......))).))))..)))))))))).))))))))))))((((((((..((((.(((.......)))))))..)))))))).((((((((((....((((((...((.....(((((((..(((((((............(((((((.((((......))))....((((((((..((((...((((.............))))....)))).......((((((((((((.....(((.((((((.((.(((((.....))))).).).))))))..)))))))))..))))))...........(((((............))))).....)).)))))).)))))))((((((((((((((...((((....((((.((((.((.(.((((((((((..((((........))))...........(((.((.......))))).)))))))))).).)))))).))))..))))...))).....)))))))))))))))))))))))))....))..))))))...))))...))))))..))))))))))).....)))((((((.(((((.((((.(((((.((...(((((.....((.....)).....))))).........((((((((....((((....(((.(((.(((..(((((.(((((((((((....))).)))))))).))))).))).))).)))............((((((((((.((....((((..((((((.....)))).)).....))))...)))))).))))))))))....)))))..)))((((((..((.(((((..((((((.............((((((........)))))).((((.....)))).......((((((((....)))))))).))))).)..))))))).))))))........((.((((((.(....).)))))))).........)).))))).)))).))))).)))))).((((.((((((..............................)))))).))))..........((((....)))).))))))).)))).....))).)))))).)))))))))))((((((((((........))))))))))(((((((......)))).)))))))....
Thermodynamic Ensemble Prediction
..{(((((((((.((((({,((.((.....)).))))))))....((((((.((((({..{(((({...|,.....,...))))).,.{{{(((((.....)))))..,,|}}....},))))))))).)))|.)))))))))}..,|||||||.(((((((..((((..((((((.(((.....{{{,((....}},,,.(((....)))...||},..,|,|.(((((((.,,,,,(({....((((((((((((((((((..{..(...((((.....))))}..}..)))))))....{({....}}}(((((.....{({,..,((,(((......,|{{.((((((((((((.,,...,{({{{,{.,,||}|{{{,{{,,{{|||{,,{,,||||,,.,,,..}}}|}}|,||}}||},.{(((((((((((,(((,.(((((...}}}||.,(((((((((.(((((((.((((((((......))))))))(((((((((...((.((((.(((((((({..(((.(.(((((((,,(.......,),.))))))).).)))...{({....,,}}|(((((((((((..(((((.((((..((((((..(((....))))))).)).)))).)).)))..)))..(((............)))...(((..(({.((({{(((((,...}}}))}((((.(((....))))))).((((.(((((....(((((....))))))))))..)))).......)))).)))..))).)))}})))),(((((.(.....))))))((((....)))).(((({..(((.((((.((..((((.(((.{{.({,..((((,,,.({((({,.(((.((((((((((({......}.)))....)))))))).)))((,....||.((((((.(((((((..(((....)))..)}.,,{{.{{{{{.{((((.(((............))).))))|,,}||}}.....|,|||.,....,.((((((........))))))|}}))}....)))))}..)))))))....)))){||{{((((.,{..........}..)))).})|((((.(((((......(((((((......)))))))....{{{{{....,,{,.{.(.{(((((((.,(.((((((((((.(((((,.{{..{((({{,...,.........||,.....,,.}},.............((((((.(((((.,.....}.))))).)).)))),.}}}}..)).)}|||....,({{{,,,..}})))))))))).,))))..))))))))}},,...)))))((((((({,((((.....,,..(((((((.....)))))))......))))))))))))(((((..{{{,..((((((((((((...((({,......,,,,{(,,,,.{||||||{,....((((((,(((....)))..,,..})))))....,}}}}},......,,......{,.((((((((((..........((((.((.(({..((...(((.(((,.((((........))))})).)))...)).))).}).))))..((((...))))((((((..((.....))..))))))((((((..((((.....))))....)))))).......{.(((((({....})))))).})))))))))).},........,.(((((((((..((((.{,,.......(((.....)))......((((((((((,{..((({.,(((......}}})))),...}}.)))))))))).........,}}.))))..))))))))),|,{((((....,|,|}}}}}}..,,))))}})},|..(((((.......))))).})}}}))))))))))))..,}}}...)))))(((((((.........(((.(((((((.,....}.))))))).)))..))))))).......))))))))),...,.,}||{,,,.....,,{{{{{...})))),.....}},)))})))).))))..)).)))).))))))))......((((((...........)))))).,(((({...})))}(((((((.(((((.((..(((.....,,})}..))},.........))))))))))})))))))).....,}))).))..)))))))))......))).))))..)))))))))|{||{{|,..,.,{{{{|{{{{{{.{{{....,..{{..((((((((((({.,((({(..(({{{,},...||||}....,,,,...|.{{{{...)))).,}}}}}.))))).))))))).}}.}}..))).))))).,)))))....))))))}...,,}}}))))},,})))))||,.(({{(,........,,))))}})))}...,})).)))))))))))).||..{((((((({((((((..,{{{||,,.,,,,.......|,......}}|,,,|.,...,,{(((((((.,..,.,,....,,.,....)))))))|||{((((({|,,...,,,{....((((.((((.((.(.((((((((((..((((........)))).........,...,.||,.........,}.)))))))))).).)))))).)))).,||||{..,,},,,,.)))))))))}}))))))}..))))))))..,},)))}}}},,,.,.,,,.)))))..))))))))))).....})){(((((.(((((.((((.(((((.{{,,.,{((({..,....,...||,|{.,(((((((((({(,,.((((..((((((,,(,{({(((,(((.{((..(((((.(((((((((((....))),,))))))).})))).))}.))).}}}....,,},,.||||,.|||||.,,},,,,}}),..,,.|||,,,.,},)))))).)))).)))))))))))))}.}}||.))})}{{{{||.....|(((((..{(.(((((..((((({.............((((((........)))))).((((.....)))).......((((((((....)))))))),))))).)..)))))}}.))))))..}})))}((.((((((.{....}.)))))))).,|,...,,}).))))).)))).))))).)))))}.((((.((((((..............................)))))).)))).},}.,....((((....)))).))))))).)))).....))).)))))).)))))))))))(((((((((({,.....,))))))))))(((((((......)))).)))}))}....

Transcripts

ID Sequence Length GC content
GAUGAUUUCUCCAUCCUGAACGUGCAGCGAGCUUGUCAGGAAGAUCGGA… 3408 nt 0.4930
Summary

The protein encoded by this gene has a nuclear and a cytoplasmic form and is a member of both the dynamin family and the family of large GTPases. The nuclear form is localized in a granular pattern in the heterochromatin region beneath the nuclear envelope. A nuclear localization signal (NLS) is present at the amino terminal end of the nuclear form but is lacking in the cytoplasmic form due to use of an alternate translation start codon. This protein is upregulated by interferon-alpha but does not contain the antiviral activity of a similar myxovirus resistance protein 1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human traumatic brain injury (TBI) patients identified the MX2 as a long noncoding RNA that forms a coexpressed pair with CXCR1, exhibiting a positive correlation of 0.9998 and association with cytokine-cytokine receptor interaction, chemokine signaling, and endocytosis pathways [Zhang et al. DOI:10.097/WNR.0000000000001756].