| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGCUGCUGCUGCGCCCCAUCCCCCCGCGGCCGGCCAGUUCCAGCCCGC… | 1032 nt | 0.5940 |
This gene is a member of the human ADP-ribosylation factor (ARF) gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6). The members of each class share a common gene organization. [provided by RefSeq, Dec 2010]
A study in rats and mice demonstrated that the ARF5 was identified as a downregulated same-trend differentially expressed gene in the corpus cavernosum of animals with age-related erectile dysfunction, where multi-omics analyses revealed conserved molecular mechanisms involving downregulation of mitochondrial activity and disruption of protein homeostasis [Long et al. DOI:10.1093/sexmed/qfaf078].