Basic Information

Symbol
MYBPC3
RNA class
mRNA
Alias
Myosin Binding Protein C3 CMyBP-C FHC Myosin-Binding Protein C, Cardiac-Type CMH4 Myosin-Binding Protein C, Cardiac Myosin Binding Protein C, Cardiac C-Protein, Cardiac Muscle Isoform Cardiac MyBP-C CMD1MM LVNC10 MYBP-C
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000256.3
Sequence length
4217.0 nt
GC content
0.6080

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1795.30 kcal/mol
Thermodynamic ensemble
Free energy: -1862.52 kcal/mol
Frequency: 0.0000
Diversity: 1098.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((....))).)))(((((.((((...(((((.((((.((((((.((((((((.((((.((((.....((.(((((((((((((((((((......((((((((((((((.((((((....((.((((((((.(((((............))))))))))).))...((((.((((((...(((.((((((((((....((((((((.....(((..((((((((......))).)).))).)))))))...((((.(((.(.(((.(((((((....(((((((...(((((((...(((.(((..((.(((((......)))))...)).....))).))).((((((((.((...(((((((((..(((..(((...((((.((((((((.(.((((.((((...((...((((.(((..(((((((((((.(......))))..(.(((...))).).)))))))).((((.((..(((...)))..))))))..((((((....))))))............(((((..((((((((((.(((.((.((((((((.((......)).))..)))))))).)))..)))))...)))))..)))))))).))))..))..)))).))))...).))))).))).))))))).))))))))))))..(((((((....(((((.((.((((((....))..)))))).)))))..)))))))((((...))))....)))))))))).((.(((((....))))).)).(((((.....)))))....)))))))............((((((((((.((((.((.((((..((((((((.((...(((((((((....(((((((.((..((((......)))).)))))))))....))))))(((.(((..(....)..))))))..((((((.....))))))...)))...))))))))))..)))).))..))))..(((((.....)))))......))))).)))))))))))).)))))))...)))).)))..))))..))))...(((.........)))))))))).))).)))(((.((((.......((((.(.((.....)).)..))))......))))..))).(((((......))))))))))).))))......))...))))))....))).))))))))))).....)))))....)).))))))).)...)))))).....))))))))..))))...)))).)))..((((......)))).))))))))))))..(((.(((((((.((.((((((..((((....)))).....(((.((((((((.....)))))))).)))........(((((((.(((((((...)))))))...)))))))((((.((((((((.......(((....)))......))))).)))))))..((((((.((((.....((....)).....))))..)))))))))))).)).)))))))..)))((.((((((((....)))).....)))).))...((((((((((.......((.((((.((((....(((((((.....(((((((((((((....(((((((((((((((((..((((..(..((...((..((((.((((((........(.((((((((((.......((((..((((((.(((.(((((((.............)))))))..))).))))))..)))).((((((.((.((((.((((((((.((((((((.((.(((((((((((.(((((.......((.(((((.....((((((((((.............((((...)))).........(((((((((....)))))))))(((....)))(((((((((...(((((((((..(((((((......(((((((....)))))))(((.(((((..(((.(.......).))).)))))..)))(((((((.....((((((((((...)))).((((((.......))))))))))))..(((((((....)))))))(((((((((((.(((.(((((.....((((.(((((((((((.....((((.......))))..))))...)))....((((((...((((.(((.((((.((((((((((......))))(((((.(.(.((((((((((..(((((..((((...))))...))))).............((((..((((((..............(((((((((.((((.((...((((......(((((((.(..(((...)))..))))))))......)))).))))))..)))))).)))...))))))..)))).......((((((.((.(((((((........)))))))))(((((((......)))))))((((((...)))))).....(((((((...............))).))))...(((((.(((..(((((...((((((((...)))))))))))))..)))))))).....(((((.(((.((..((.((((.((.....(((.....)))...)))))).))...))))))))))..)))))).........)))).)))))).).)))))).))))))...(((........))).)))).))).))))...))...))))..)))).)))).))))).)))))))))))))).)))))))...((....))))))))).((((....(((((.((.((.......)))).))))))))).))))))))).)))............))))))))))))))))...))))))))))))(((....)))..)))))))........(((((((((((.((..(((...........((((((..(....((((((....))))))....)..)))))))))..)))))))).)))))....((((.(((....)))))))((((.((.(((..((((((((...(((..((((((...(((((((.(.((((...))))).)).....)))))...)))))).))).))))))))..)))...)).....)))).))).).)).)))))))).))..)))))).)))).)).))))))..)))))).)))).).....)))))).))))..))...))..)..)))).)))))))))....((((.......))))..((.(.(((((((..(((((.((..((((((((((((((........((((((.....)).)))))))))))).))))))..)).))))).)))))))).))))))))))....))).........((((((.(((((.....((...(((.......))).))...))))).))))))((((..((.((....))))..))))........)))))))))).((((.....))))))))))).))))))).).))((........)).)))))))))).(((((((((.(((.....))).((((((((((..((....((((.((((....)))).))))....((..((((((((((.((((((.((....)))))))).)))))..((((((.....(((((.(((((((((((((..((((((.(((....((((((((((((.(......))))))).))))))...(((((((((((((.(((...))).)).))))))((((.(((((.((((((((......(((((((.....))))))))))).)))).)))))....)))).....))))).(((((.......)))))((((((((((......))))......)))))).(((((((((((.((((..(((...)))....)))).)))).....)))))))....)))...))))))..))))).(((....((((.(.(((((.(.((((....)))).).)))))).)))))))))).))))).)))))......)))))).......)))))..)).((((..((((((..(((((((....)).))))).)))))))))).......))..)))))).)))).........)))))))))((((((.....))))))...((((((((((((....))))))......))))))...)))).)))))........
Thermodynamic Ensemble Prediction
.,...{(((,,,,{((({{(((((,{(((((.{.((((((..,.(((({,,,,||}}}|}||.)))))).,.)))}|,,(((((.(((((,(((,.{..{((((,,((..,,||.|||||{(({{(,..,||||||.||||,}}}}}.}}}}).||{{,({,,,...(({{(((((((({{,,||||...{(({((({{.,||{|{{({((.....{{,.|(({{((((.,....}||,|}{|||.,,})))}...}|||,..,.|,||||{(((||,..}}|||.,||,.}|||}}}}}}))}||(((((((..((((,{((({,((({{..||||.,{(.(((((.(,,(((((.(({...,,,|||{,}}}}},}}}}}.}}|{{{.((({.{{((.(({...{{....|}}},))),,}})}.(((((((((((.,......})))..(.(((...))).).)))))))).(((((((..(((((.((((.,...((((..,,{((,{,|.((((((.{.....,,.(((((..((((((((((.(((.({{(((((({{.{{......}}.}},.)))))))).)))..)))))...)))))..)))))..}.))))))}.))})),.))))....))))))))))))).))).{||{|}}},,,)),}|((((((...,(((((.((.((((((....))..)))))).))))),}))))))}((((...))))..,,}|||||||||.((.(((((....))))).)),{((((.....))))}.,||||{(({((((.((((((..((((...((((({((((,(((({..((((....)))).,,,)|}}}..}}}}{((((((.,.((((((((((({.{(({((((({((.((((((({.(((..(((..(.{(|((..(((({{.((((((.....)))))}...,.,....,,,.)))))).,)).}))..)))}..((((({{{{.,,,,|{{{((.{{.|,(((|({.,..))),),}}},}..})})).)))}.||.,,,,,,..,,)))}}))}))..)))))))))))})}||{|,,|{((((...,...|||..,||}|||..))|){,{{.|..,,,,,||.((({,{(((,...}}|}))),{|||||||,.,|.,{{,.||...})))}}..,.}))}))),|}}|||}.{{{.|||{.{(.{..,|(((.((((...((((,{,....})))))...))))))).}}.}.)))))).})).},}}}}},.,))})))|||||}..,}})}))})}))),)))))))).))))..})))))}...(((.((((((((.....)))))))).)))....(((.(((((((.(((((({...}))))))...)))))))))),.((((((((.......(((,...)))..},,,))))).))),)))))...))))..)))))).,,},}},)}}})))}}.,}))},,}})))}}})),))))})})))))))))..)))))}}})))))}....)).))))...((((((((((.......((.((((.(({{....{{(((({.{{{{(((((((((((((....(((((((((((((((((..((((..(..((...((..((((.((((((........(.((((((((((.......((((..((((((.(((.(((((((.............)))))))..))).))))))..)))).((((((.((.((((.((((((((.((((((((.((.(((((((((((,(({((,......|{,{{(((.....((((((((((......,{,{...,,,,...)))).........(((((((((....)))))))))(((....))){((((((((...(((((((((..(((((((......(((((((....))))))),,,.(((((..(((...,.....).))).)))))..,|,(((((((.....((((((((({...}))).((((((.......))))))))))))..(((((((....)))))))(((((((((((.(((.(((((.....((((.(((({{{((((.....((((.......))))..))))...}}}....((((((,{.((((.(((.((((.((((((({((......}})){((((,{.(.((((({((({.{(((((..((((...))))...))))),,.,,..,,,,..{{({..((((((.....,,,....,{(((((((((.((,(({(,,.{(({.,..||(((((((.(..(((...)))..))))))))....}})),),||})))||)))))).))).}}||}|}}..||||.{{....{{{{{{.((.(((((((........)))))))))(((((((......)))))))((((({...}))))).{{{((((((((.,...........,.))).)))}.)}|||{.((((..(((((...((((((((...)))))))))))))..))))))})|,,},{{(((,{(({{{..{{,(({(,((....,|||,,..,)))},,)))))),)).,,|}},.)})))}})))}},)}}},,,.,)))}.)))))),)},))))).)))))),}.{((,....,,,|}}.}))).))).))))...))}}}))))..)))).)))).))))).)))))))))))))).)))))))..,{{....}}))))))).((((....{((((,(({({...,}}})))).})))))))).))))))))).)))............)))))}))))))))))..,)))))))))))}|||....},},,)))))))........(((((((((((.((..(((..........,((((({,{(.{.{((((((....)))))).,.,,},)))))))))..)))))))).))))).,,.((((.(((....))))))){{((.{{.(((..((((((((...(((..(((((({..(((((((.{,((((...))))).)).....))))).},)))))).))).))))))))..)))...})....,)))).))).}.)).)))))))).))..)))))).)))).)).))))))..)))))).)))).).....)))))).))))..))...))..)..)))).)))))))))....((((.......))))..{,.,,(((((((..(((((.((,.(((((((((((((,.......{((((((.....)),}))))))))))).)))))),.)).))))).)))))))).,}))))))))....)))..,..,..,((((({.{||||}}....,}},}||.{{....,,)},|||.}}}}),)|||||((((..((.((....))))..)))).,,,,,..))))))))))}||{{.....)))}))))))}.))))))).).))||.,,.....)).)))))))))).(((((((((.{((.....}}}.((((((((((..((....{(((.((((....)))).))||{{{,((..((((((((((.((((({,((....)))))))).))))}..((((((..{{.(((((.(((((((((((((..((((((.(((....((((((((((((.(......})))))).))))))...(((((((((((((.(((...))).)).))))))({((.(((((.((((((((......(((((((.....))))))))))).)))).))))).,,.},,,.....))))).(((((.......)))))((((((((((,.....))))).....|))))).(((((((((((.((((..(((...)))....)))).)))),..}))))))))....)))...))))))..))))).(((..,,((((.(.(((({.(.((((....)))).).}))))).)))))))))).))))).)))))..},..)))))).......)))))..)).......((((((..(((((((....)),})))).)))))).))))},....))..))))))}}))).........)))))))))((((((.....))))))...((((((((((((....))))))......)))))).)))))))))))))),.....

Transcripts

ID Sequence Length GC content
AGUCCCUCUUUGGGUGACCUGUGCCUGCUUCGUGCCUGGUGUGACGUCU… 4217 nt 0.6080
Summary

MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

Forensic Context

A study in rhesus macaques identified the MYBPC3 as a differentially expressed gene associated with hypertrophic cardiomyopathy, where it was upregulated in affected animals [Rivas et al. DOI:10.1038/s41598-024-82770-4]. In a forensic context, an mRNA profiling assay for organ tissue identification utilized the MYBPC3 as a heart marker, with its primer sequence specifically adjusted in an updated multiplex to ensure human specificity and reliable detection in forensic samples [van den Berge & Sijen DOI:10.1002/elps.201700241]. A study in humans identified cardiac myosin-binding protein C (cMyBP-C) as a robust emerging biomarker with high cardiac specificity and sensitivity, showing significant elevation in cases of acute myocardial infarction and sudden cardiac death [Cătinas et al. DOI:10.3390/ijms26146818].