Basic Information

Symbol
MYC
RNA class
mRNA
Alias
MYC Proto-Oncogene, BHLH Transcription Factor BHLHe39 C-Myc MYCC V-Myc Avian Myelocytomatosis Viral Oncogene Homolog Class E Basic Helix-Loop-Helix Protein 39 Myc Proto-Oncogene Protein Transcription Factor P64 Proto-Oncogene C-Myc Myc-Related Translation/Localization Regulatory Factor Avian Myelocytomatosis Viral Oncogene Homolog V-Myc Myelocytomatosis Viral Oncogene Homolog BHLHE39 MRTL
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002467.6
Sequence length
3721.0 nt
GC content
0.4878

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1179.70 kcal/mol
Thermodynamic ensemble
Free energy: -1246.23 kcal/mol
Frequency: 0.0000
Diversity: 854.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((.........)))))))...(((((((((.(((((((((...((((.((((((.((.(((((((((((((((((.((..((((..((...((((((((......((((((....(((((((..(((...)))..)))))))((((((..........))))))...((((...))))))).))).........(((.....)))(((((.(((((((((((..(((............))).)))))).((((.(......).))))((((((((.............(((((....)))))((.(((((.((((...((((.......))))..)))).))))).))......(((((.((((((.(.....).)))))))))))))))))))((((((.((.....)).)))).))....((....)).......((((((....)))...)))(((((((.((((((.((((....(((((.....)))))....))))..(((((.......))))).(((...)))..((((.........)))).)))))).)).))))))))))..))))))))).))))...))..))))..)))))))))))))))).....(((((.(((...)))..((((((....)))))))))))..((((((((((((((((.(((((((.........((((((((((((.(((.(.(((..(((.(((((.(((....)))..))))).)))))).).)))..((.((.....)).)).....))))))).))))).......))))))).)))))))..))))))))).((((..((...))..))))))))).......((((((.(((.......)))))))))......))))))..))))....)))))))))(((.(((((((((....((((...((((((.((....)))))))).))))..(((((....).)))).......(((((((....(.((((((..(((...((((.((((...)))).))))...))).(((((.(((.((((((((.((.(((((((((.....))))...........((((........)))).(((((((((....)))).))))).........))))).)).)))))))))))...))))).((((((.......((.(..((((((((((....((..(((((((.((((.....)))))))))))..)).(((((....))))))))))).))))..).)).(((....))).)))))).(((((((..(((....................)))..)))))))(((((....)).)))......)))))))..))))))))))))))))..)))...(((..((((((((((((((((.((............(((((.((.(((((((((...))))))).........((((((.........))))))((.((((.((.((.((((.(((((.......))))))))).))))))))..))....)).)).)))))...........((((((((((.(((..((........))..)))((((........))))((((...(((((((((....((((((.(((((((((.((.(((((((......)))))))..(((((((.....((((..((((((....(((......(((.((..(((..((.((((((.....))))))))...(((((((....(((((.((((.....((((((.......(((((......))))).....(((....((((((((((((........))))))))))))...)))......((.......))....((((((((((((....))))))))))))...............((((((((((..(((((((((..((((((((((((....))))))).....))))).....(((((....(((((...(((((((................)))))))..)))))...)))))............((.(((((((((((......))))))))))).))...............))))))))).))))....)))))).....(((((((((.......))))))))).........((((..(........)..)))).....)))))))))).))))).....)))))))......)))..))))).....)))))))))))))...))))))).)))))))))))...(((((....)))))..)))))))))))))))...))))...))))))))))..((((((((((((((((((...))))))).)))...)))))))).......((((....)))).........(((.....((((.(((..(((((((((.((..((.((((((.(((((.(((((.(((..(((((((.(((((((..((((((((((((...(((((((.(..((((....((((((((((......))))..))))))......))))).)))))))..))))...(((.......)))....(.((((.....)))).)...((.((((((.(((....)))((((.....(((((((...((((.(((((((((((((....(((..((((((((...))))))).)...)))......))))))((((((.(......)))))))...((.(((...))).)).((((..((((((((......))))))))))))...(((((...((((((((...((((...))))...((((....((......))...))))....))))))))...))))).........(((((...))))).)))))))))))..((.(((....))))).((.(((..((((((((..(((................(((((..((((((.((......(((..((((((.(....))))))).)))....)).))))))))))).)))..)).)))))))))))..(((((...(((..............)))....)))))...((((((((((((((((((((..((((((.(((......(((((.((.((..((....))..))...)).)))))......).))..)))))).))))))...)))))........))))))))).........))))))).))))....)))))))).))))))))........................((((((((..((.......))..))))))))..((...))..))))))).))))))).))).))))).......((((((((((((((.((....)).))))..............((((((.....))))))....)))))..))))).....................))))))))))))).))))))))))).........(((((((.(((....((..((((...))))..))..))).)))))))...........)))))))....))).(((......)))....)).))))))))....((((((....(((((((....)).)))))..))))))...)))))))).)))...((((((.......((((........)))).....))))))...........................))))))))).
Thermodynamic Ensemble Prediction
..(((((((.........))))))),{{,(,(((((({((((((((({,,((((.((((((..(,(((((((((((((((((.((..(((({((..,,(((,,(((.,,,{.((((((....(((((((..(((...)))..)))))))((((((..........))))))...(((,...})))))).)))..,......|||.....|||(,((({(((,,((((((.,,((...........,)}).)))))).((((.,......).))))((((((((.............(((((....)))))((.(((((.((((...{(((.......}))}..)))).))))).))......(((((.,{(((({(.....,,)))))))))))))))))))((((((.({.....)}.)))}.)).,,.,,....}).......,||(((....))}..,||{(((((((,.(({((.((((..,.{((((,....})))).,,.)},)|,|{||,,,.}},.))))),{||...|||,.,((({..{{,,.{||,,.))),))}),.))))}})))}..)))))))))}),})}.,).))))))..)))))))))))))))).....{((((.{(|...})),.((((((....)))))))}}))..((((((((((((((((.(((((((......,..((((((((((((.(((.(.(((..(({.(((((.(((....)))..))))).)))))).).)))..{{.((,...,)).)).....))))))).)))))..,,}..))))))).)))))))}.))))))))).{{(({.{{...))}.))))))))}.....{.((((((.(((.......))))))))).,....)))))),,||||...{|}}}})))}(((.(((((((((....((((...((((((.((....)))))))).)))}..(((((....).)))).......(((((((....(.((((((..(((...((((.((((...)))).))))...))).(((((.(((.((((((((.((.((((((((((({..(((((.......,,.((((........)))).,)).))))).})))))),..............})))).)).)))))))))))...))))).((((((.,.....,,.{..((((((((((....((..(((((({,((((.....)))))))))))..)).(((((....))))))))))).)))).,)})),{{{....}}){||||},.(((((((..(((............,.......)))..))))))){{(((....))}})),,....))))))}..))))))))))))))))..)))...(((..((((((({((((((((.{,.........,..(((((.((.(((((((((...)))))))....{{{...,|||{.........,||||{((.((({,((.((.,(((.(((((.......)))))}))).))))))))..)))},,}).)).)))))...........(((((((((({((,..,,..}}}}......||,,,,{,.......||}|{({{...,|{{{||||{,...,((((,{(((|,.(({(({{(({(((,{{{{.|||||||,,(({(((({{{{,{,,,.{{{.,,({{.,(({.,..,{{({.{,{{((({..({,,,,,..}}..))))))},.|}|||,..|}}},{|||,.|||....}}|...}}})))),.(((((......)))))...{{((({{..((((((((((((........))))))))))))...,||....,|{,..,....||,...((((((((((({....})))))))))))..,,,|...,,{{{,.,..{(({{,{{(,,,,,,{|}}||||||,,,|||,,,.,||||||{,,.,,||||{,,,,({(((,...{((((...{((((((................))))))),.))))),,,)})))............((.(((((((((((......))))))))))).))...,.......,,,.,,|||||,,.,,}|||,..,,,||{{|..(((((((((.......))))))))).....},,,||||,,{......,}),.)}))..,,}}}}))))))).})))))}},}))))}}),,,....,,........{(((((((((...|,..........,)......))).))))))}{{{....}))))}}})),,,))))))}},},,))))),.})))))))))..{{{{{{{{{{{{(({(({,,,}}}}))).)))}.{||}}||||.{{....,,,,},.,)))}.}}},,,,.{({..,..(((,{(((..(((((((((.((..((.(((({{{(((((.(((((.(({..(((((((.(((((((..{(((((((((((,,,((({{(({({,((((,.{{((((((((((......)))}.,}}))))..,,..}}}}|,}}}}}}|,,}}}}|,,{|{.....,,|},...,|,{{{|,,,..})))||,..{{{(({{{||{{{...,|}|((((.....(((((((...((({{((((((((((((,....(((..((((((((...))))))).)...)))......,,,}}(((((((.(......))))))))..((.(((...))).)).((((..((((((((......))))))))))))...(((((...((((((((...{(({...,})}...{(((....((......))...)))}....))))))))...))))),{,,,....,||||}..))))).}))))))))))..{{,{{,....}}||}.,|,{,,.,{((((({{,.{((.,.....|},......(((((..((((((.((......(((..((((((.(....))))))).)))....)).))))))))))).))),.)),)))}}}}}}}}..(((((...(((............,.)))....))))).,.((((((((((((((((((((..((((((..,{,.,,,,(((((.((.((..((....))..))...)).)))))...,}.}}),..)))))).))))))...)))))........})))))))).........))))))).))))}.},))))))),.)))))))).,,,..,,,,,.............{(((((((..{{.......,}..)))))))}..{{...,,..))))))).))))))).))).))))).......((((((((((((((.((....)).))))......,,.....,((((,,.....)))))}....)))))},)}))).....................))))))))))))).))))))))))).........(((((((.(((....((..((((...})))..))..))).)))))))...........)))))))....))).|||},....}}}....}).)))))))}....((((((.,..(((((((....)).))))).,))))))...)))))))).))).,,{{,||,,....}}}}))).}.))}{|||,................}}},....{{{{..,,......,,)),,))),

Transcripts

ID Sequence Length GC content
GGAGUUUAUUCAUAACGCGCUCUCCAAGUAUACGUGGCAAUGCGUUGCU… 4515 nt 0.5041
AACUCGCUGUAGUAAUUCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGC… 3721 nt 0.4878
Summary

This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017] CIViC Summary for MYC Gene

Forensic Context

A study in mice demonstrated that the MYC is a downstream target of cyclin-dependent kinase 9 (Cdk9), where its mRNA expression was significantly decreased following Cdk9 knockdown in cardiomyocytes, linking it to pathways regulating cell survival under hypoxic stress [Xue et al. DOI:10.1161/JAHA.122.026160]. In human corpus cavernosum tissue, single-cell transcriptome analysis identified the MYC as a WNT/β-catenin pathway target, with its expression significantly higher in the fibroblast subcluster FB1 from patients with organic erectile dysfunction, indicating its role in pathological fibrotic signaling [Zhao et al. DOI:10.1038/s41467-022-31950-9].