Basic Information

Symbol
ARF6
RNA class
mRNA
Alias
ARF GTPase 6 ADP Ribosylation Factor 6 ADP-Ribosylation Factor 6 EC 3.6.5.2
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Drug abuse diagnoses

MANE select

Transcript ID
NM_001663.4
Sequence length
3875.0 nt
GC content
0.4284

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1183.60 kcal/mol
Thermodynamic ensemble
Free energy: -1252.56 kcal/mol
Frequency: 0.0000
Diversity: 852.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((.(((.(((((........(..(((((((((((.((((((.(((((((..((((...))))..)))).((((((((((.(((.(.(((((..(((........)))..))))).).)))....))))))))))((((((((((((((((.((.(((((((...(((((((((((..((((.(.((((.(.(((((((....((((((((((((....(..((((..(..((((...))))..)..))))..)....)))).))))))))....)))))))).)))).).))))))))..)).)))))..))))))).)).......(((((((((((((((.(((.(((((.((....)).)))))))).))).....(.((((......)))).)))))))))).)))(((((((..((((((.((..(((..(((((.(((.((....((.((((....)))).))...)).))).))))).)))..)).))))))..)))))))))))))))))))))))...))))))))))))))))))))..)..((((((((.((((...(((...((((((.((..((..(((((((((...(((.((.(((((((((.(((((.((((......(((.((((((((..((((((.((.(((......((((.((((.((.((((.((........)))))).)).))))..))))......))).)))))))))))))))))))((((((((.(((.....)))))))))))..((((..(((((((..(((((((...))))))).....))))))).)))))))).))))).)).........))))))).)).))).....))))))).))..)).)).))))))...)))))))....)))))))).))))).....((((...))))))).))))............((((((((((.(((((((((((((.((((....)))).))).....(((..((((((.....)))))).))).(((((((.((.......((((((((((..((((((.....))))))..........))))).)))))...)).)))))))((((.((((((((((((.....(((((.((((((...((((.....((((((.......(((.((.(((((.((.........(((((.(((((......))))).))))))).))))).)))))..))))))........(((((((((((((((((((........................((((((((.....((.(((((.((((((...((((.((((.........)))))))).)))).))))))).))....)))))))).)))).)))))))))).)))))....))))..)))))).)).))).....)))))))))))).))))(((((((.(...(((......)))...).))))))).......)))))))))))))...(((((((((((.........(((((((..(((((((..(((.(((((..(..((((.((((((..(((((...((((((.(((((..((((((.....(((((........)))))((((((((.((((((((.(.((((..(((......(((((((((((((((....((((((..(((((((((.((((((..(((((((.(((..((((((.(.((((....(((.((((((((((((((.((....(((((((......)))))))(((((((((.(((((((((((((..((((((.........(((.(((.......(((((.........))))).......)))))))))))).)))).((((....))))...(((((((((((((((((.......)))))).((.(((((((.....))))))).))......((((((((((...))))))).)))....(((((.....))))).....)))).)))).)))..(((((((....))))))).))))))))))).))))))))))))..))))))))))))))..)))))))))))....)))...((((((((((((....)))))))....)))))..((((((....))))))......................(.((((((((.(((..............((((...((((((.(((((((((((................))))))(.((((((.....)))))).).((((((.(((((......(((((((((.....)).))))))).......(((((((....(((((((((.((.....)).)))))))))......)))))))((((((...))))))......((((((((((((.......((((.((......)).)))).....))))))))).))).......))))).)).))))(((((((((.....((((............))))......)))))))))))))).))))))))))...((((((..((.((((...((((((((....))).))))))))).))..))))))..(((((......((.((((..((((.....((((((.((((...(((((..((((....))))))))))))).))))))........((((.(((((((.......))))))).)))).)))).))))))...)))))....(((.(((((....))))).)))))))))))))).))))))))..)))))).....(((((...(((((....(((........))).....))))))))))))))))))).....(((((..((.(((((..(((((..(((..((((....(((((((((((....((((((.(((((((((((.........((((((((.............)))))))).....(((((((..(((((....(((.((...((((.(((.((((.......((.(((((.(((((((((...((((.((((....(((((((((((((.(((((.((......)))))))..))))))))).............))))..(((..(((((...........))))).)))(((((.(((((.(((..(((((.((....))..)))))..))).)))))...)))))...............)))).))))...)))))))))))))).))))))..(((((....))))).))).))))...)).))).)))))..)))...))))........((....((((.((((....)))).))))...))...)))))))))))))))))...((((((......))))))...)))))))))))..))))..))))))))..))))).))))))))))))))))))).........)))))))))))).)))).).)))))))).))))))))(((((.......)))))........(((((((((((....((((.......)))).((((((......))))))....)))))))))))........))))))..))))).))))))...))))).))))))((((((.......))))))(((........))).((.((((((....)))))).))))))..).....)))))..))).)))))))..)))))))........))))))))))).(((((((((......)))))))))............((((....))))).)))))).(((((((.........)))..)))).((((((((((((((..(((((.(((((((.....))))))))))))...)))))))....)))))))...
Thermodynamic Ensemble Prediction
..,((,.{((((.{(((((..{{((..(((((((((((.((((((.(((((((..((((...))))..)))),((((((((((.(((.(.(((((..(((.,,...,,)))..))))).).)))....))))))))))|((((((((((((((({(({((({((({,.,((((((.,||,.||||,|,((((,(.(((((((..{{((((((((((((....{..((((..(..((((...))))..)..))))..).,..)))).)))))))),...)))))))).)))).},||||||||..,,|))))}}}|((((((.{(.(,..({(.((((...(.((((.(({,(((((.((....)).)))))))).)))).}...))))))},,.)),)))))))))))))})))||{{{{(,,({{{{|,((,.({(.,(((((.,,(,(({,.,(({,((({.{{||||.},...})}))),})))).)))}.)),)))))),,)))}))))))))))))))))))}...))))))))))))))))))))..),{((((((((.((((...(((...((((((.((..((..(((((((((...(((.((.(((((((((.(((((.((((......((,{((((((((..(((((({((.(((......((((.((((.,(,((((.((......,.)))))).)).))))..))))......))).)))))))))))))))))))((((((((.(((.....)))))))))))..((((,,(((({({..(((((((...))))))).....))))))}.)))))))).))))).)),.......,))))))).)}.))).....))))))).))..)).)).))))))...)))))))....)))))))).,}}}......,)})...)))))}}.))))............((((((((((.(((((((((((((.((((....)))).)))|....(((..((((((.....)))))).}}}.(((((((.((.......(((({(((((..{(((((.....)))))}..........))))).}))))...)).)))))))((((,(((((({{{{{{....,((,((,(((({,.,.(((,{{..,.{{{,.,,,....(((.....,..,,{....))}...{((((,({(({,..{{{||||},}}},}))}))))).))))),}|}||||||.,,,..,((((((((((((({,{{...{{,...................{{((((((..,,,{(,(((((,({(({{...,{{{,{{{{.........)))))))|.}))).))}}}}}.}}....)))))))).)))).)))))))))).))))}....})}}.,}}}))}.}}.,},.....}}}))))))})}.,}}}|||||||,|...{{{..,,,,))).,,).))))))),,,....})))))))))}}}...(((((((((((.,.....,.(((((((..(((((((..(((.(((((..,..,{{{.((((((..(((((...((((((.(((((..((((((,{,{.(((((,,,,,...}}}}}((((((((.((((((((.(.((((,.(((......(((((((((((((((....((((((..(((((((((.((((((..(((((((.(((..{{{{((.(.((((....((,{((((((((((((((.((....(((((({......))))))}((((((({,,((((((((({(((..((((((,,,......{{{.{({.{,,|,.(((((.........))))).......}}})}}}))))).)))).((({....})))...(((((((((({((((({.,.....}}}))}.{(.(((((((.....))))))).)}......(((((((((,...,)))))).))}....{((((,...,))))}.....)))).)))),,))..(((((({....})))))).)))))))))}).)))))))))))}.,))))))))))))))..))))))))))}....)))...((((((((((((....)))))))....)))))..,{(({{....||,,,,....,,,,..............{.((((((((.(((.{{{......,,,.,,((,,,((((({.((({(((((((..,.,.....,,....)))))}|,{(((((.....}}}})}|}|{{{{{(,(((((,,,...(((((((((.....)).)))))))....,.,(((((((..,,(((((((((.({.....)).)))))))))......)))))})||{{{{,,,||}}||,.{,,.(({(((((((((.......((((.((......)).)))).....))))))))).)}},,,....}}})),}),))||(((((((((.....((((............))))......)))))))))))|||..,|||||}}}.,.({((((,.,(,((((...((((((((....)))},))))||||,,,..))))))..}))})),,).,}))}..,...,{{{{{{,{{{{{|,||||,..(((((..((((....))))))))))))|,||||((((((.{{,((((.(((((((.......))))))).))))..,}).))))))}...))))}..,(((.(((((....))))).)))))))))))))).})))))))..)))))).....{((((,..{((((....(((........))),.,,.}}}))))))}))))))))).....((((,..((.(((((..(((((,.(((..((((....(((((((((((....((((((.(((((((((((.........((((((((.............))))))))...{,{{,{(({..{((({.,,|||..||..|({((|{{{,{{(({..,{{,{{,(((((.(((((((((...((((.((((.,..((({(((((((((.((({{,((,.....})))))),.))))))))).............}}}}..(((..(((((...........))))).}})||{{(.(((((,(({..{((({.{{....)),,)))))..}}}.}}}}}...}}|}|,....,,..,.,...)))).))))...))))))))))))))...,,,,..(((({....))))).|||.,|||{...,..,,.,,)))}.,)),..}}}},...,}|,{|....((((.((((....)))).)))),}}},,,,)))))))))))))))))...((((((......))))))...)))))))))))..))))..))))))))..))))).))})))))))))))))))}........,)))))))))))).)))).).)))))))).)))))))){{{,....,,..,,|||{.....,}{{{((({{{{|,|..{{{{.......}}}}.((((((......)))))),},,)))))))))}).....},,))))))..))))).))))))...))))).))))))((((((.......)))))),{{........}}}.{{.((((((....}))))).})))))..,.....)))))..))).)))))))..)))))))........))))))))))).{((((((((,....,))))))))}............{(((....))))).)))))).((({{{{....,,,..,}}..)))).((((((((((((((..(((((,(((((((.....))))))))))))...))))))),...}))))))}}.

Transcripts

ID Sequence Length GC content
CCGGCAGCGGCGGCGGCAGAACUGGGAGGAGGAGUUGGAGGCCGGAGGG… 3875 nt 0.4284
Summary

This gene encodes a member of the human ARF gene family, which is part of the RAS superfamily. The ARF genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The product of this gene is localized to the plasma membrane, and regulates vesicular trafficking, remodelling of membrane lipids, and signaling pathways that lead to actin remodeling. A pseudogene of this gene is located on chromosome 7. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the ARF6 mRNA is an age-related gene identified for the first time in peripheral blood and was selected as a predictive feature for a robust age estimation model using machine learning, with the best-performing elastic net model achieving a mean absolute error of 6.72 years on the test set [Liao et al. DOI:10.1016/J.Fsigen.2025.103373]. A separate study in male mice found that the ARF6 protein is a potential target of miR-128 involved in methamphetamine-induced behavioral sensitization in the nucleus accumbens, where its protein expression was decreased by methamphetamine treatment and further modulated by miR-128 manipulation [Li et al. DOI:10.1111/adb.12881].