| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCCGGGUCGGCGCUCCUGCCUCCCUGCAGGGAGCUGCUUAUGGGA… | 1202 nt | 0.5957 |
Enables 3'-5'-RNA exonuclease activity. Involved in mRNA processing; mitochondrial RNA metabolic process; and rRNA processing. Located in mitochondrion and nucleus. Is active in mitochondrial matrix; nucleolus; and nucleoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that the MYG1 was one of 14 genes selected in a stepwise Fisher discriminant analysis model for classifying wound age into groups of 4–12, 16–24, and 28–48 hours post skeletal muscle contusion [Du et al. DOI:10.1007/s00414-018-01990-2].