Basic Information

Symbol
MYH1
RNA class
mRNA
Alias
Myosin Heavy Chain 1 Myosin Heavy Chain IIx/D MyHC-2X/D MYHSA1 MYHa Myosin, Heavy Polypeptide 1, Skeletal Muscle, Adult Myosin Heavy Chain, Skeletal Muscle, Adult 1 Myosin Heavy Chain 2x MyHC-IIx/D MGC133384 Myosin-1 MyHC-2x Myosin, Heavy Chain 1, Skeletal Muscle, Adult Epididymis Luminal Protein 71 HEL71
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_005963.4
Sequence length
6023.0 nt
GC content
0.4919

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1936.20 kcal/mol
Thermodynamic ensemble
Free energy: -2035.22 kcal/mol
Frequency: 0.0000
Diversity: 1529.54
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.........((((..((((.((.((((((...(((((((((((((.......(((((((.(((((((.(((.......((((((.((((.((((((.((....((((((((((((..(((...(((((((((((.(((((.............)))).(((.((((((((((((....(((((((((((.(((((....))))).))(((((..((...((((((((((((.........((.(((..(((((((...((((((((((.(((((........)))))....(((((...)))))..((((((....(((....(((((...((((.................)))).)))))....)))...))))))..(((((((((..(((.((((.....(((...((.(((....)))))...)))..))))..))).)))))))))((((((((((((.(((((.((...)).))))).)))))....)))))))((.((((...((((.((..(((.......))).))))))..)))))).)))))))))).)))))).)..))))).(((((....))))).(((((((((...........)))))))))(((((...)))))(((((......))))).((((.....))))..(((((((..((((((...)))))).)))))))........(..(((((......)))))..).....))))))))))))))..(((......)))..((((((.((((....)).))...))))))..((((((..((.(((((........))))).)).))))))......(((((((..((.((((((.((....))...(((((((((...(((((.((.........(((((((((((....((((.(((((.((((...))))))))).)))).....)))))))..))))))))))).....))))))))).....)))))).)).)))))))..))))).......((((........))))..))))))))).(.(((((((((...)))))).))).)........((((((((.((.....))))))))))..)))))))))))).)))...((((...((((...(((((((((((((((...)))))).)).))))))).))))....)))).((....))...).))))))).))))...)))))))))......((((((.....)))))).)))))).....)).))))))....(((.((((((..(((..((...(((....)))...))..)))..)))))).)))(((...))).....)).)).))))))((((..(((..((((((((.(((....((((((............(((..(((((........)))))..)))..)))))).....))))))).)))).))))))).((((((.((((((((((((((((((((((((((((...)))))))(((((((((.(((....))).)))..........((((((((((...)))))))))).(((((((((((((.((.(.(((((((((((((.......(((((..(((((((((....)))))...(((((((((((...((.(((((((.((((.....))))...))....))))).))..))))))))))).((((((((..((((.((...)).))))..)).))))))......((((.(((.......))).)))).......))))..)))))....(((((.((.((((...)))).)).)).)))..)))))))))...........(((((((..(((........))))))))))..)))).))).)))))(((....))).........)))))))))))))).(((((.((((.......))))))))).(((((((((((..(..((..(((((((((((((...((((((((.((((.........((.((((((((...)))))))).))((((...))))((((((((((((.....)))))....((((.((.....(((((....((((((......((((((((((((((((.(((((((...........((((.(((.((.((((((.(.((((..((((((.((.(((((((((...(((.(((((....))))))))..((((((..(((((.(((.......))).))))).)))))).......((((.((((..(((((..(((((((.(((((((..((((......))))..)))))))....((((((((........))))))))..))).))))....)))))..))))...))))(((.((((..((.(((((((..((((..((.(((.(.(((((....)))).).).))).))..))))(((((.(((((((.(((((((((..((.....))...))))))((.((....)).)).(((((.....)))))...((((((.......)))))).(((((((......(((.((((.(((((....))))))))).))).)))))))..(((.(..((((((((((..(((((((((.....(((((...(((((....((((..((........))....)))).....(((((........((((((....((..........))....)))))).........))))).))))).((((((..........)))))).((((((..((...((...((((.(((((((((((((..........(((.(((........)))..)))...((((((((((..(((...........)))..)).....))))..)))).........))))..))))))))).))))..)).....))..)))))).((.((((((..............)))))).))(((((((.(((......))))))))))...............((((.........((((.....))))...........))))(((((((((((....)))).....(((..((..(((((.......))))).)).))).......)))))))........)))))....))))))).....((((......))))...............(((((.....))))))).))))))))))(((((((((((..............)))))..))))))....).)))...(((..((....(((....)))....))..)))....(((((...)))))................(((..((((((...((((((.........)))))).......((((.(((((.(.((((.(((........)))...)))).).)))))))))........))))))..)))....((((((.(((.....((.((........)).)).))).))))))((((((((......(((((........)))))......))))))))...).)).)))))))..).)))).))))))))))))).)))))))))))).((........)).....)).)))))))))).)))))))...........)).))).))))..((((((.((((.(((((...((.(((.((...))))).))......))))).).))).))))))....)))))))((((.........)))).((.......))....(((((..((((....((.....((....)).....)).....)))).)))))....((((((...))))))....(((((....)))))....))))))))))))....))))......))))))...)))))....(((.....((.((((....)))).)).....)))))))))..))))))).((((((..........))))))....))))))))))))........((......)).))))).).)))))))((((((......))))))......(((.((....))))).....))..).)))))))))))....((((....((((....))))....(((((..((((((...((((.((((..((......))..)))))))).))))))))))).......)))))))))......))))))))))))))))..))))))))).))))))).))))))).......)))..)))))..((((((.(......).))))))((((((((.(......)))))(((((((((...))))))))).......(((((..((.(((..(((((.(((((((((((((((...((((.(((.(((((((..(((...)))..)))((((.((((....)))).)))).........)))).))).(((((((.......((..((((.(((....))).)))).))....((....))..(((((((......))))))).........((((((.........((((((((.(((((((.....((.((((.(.((((((((((((.(((((....((((((((((((((...(((......)))..........((((((((((((((((...)))))).)))......)))))))..............((((.....)))).............)))))))..........))))))))))))..(((((((....))))))))))))).)))))).).)))).)).......((((((.((((((((((((.(((...))).))))).))).(((((((.......((.((.(......).)).))))))))).))))....((..((((.........))))..))(((.(((......))).)))(((....)))..)))))).(((.(((....))))))...........((((....)))).......(((....)))......((((((.....)))))).))))))).((.((((((......((.....))......)))))).)).....(((((((.((((((((((((((((((.((((((..(..((....))..)..)))))).))).)))))((((.......)))).((((.((..........))))))(((((.(((((.......))))).)).((((((.....((.(((((...((((((((...)))).)))).))))).))))))))...)))......(((((.(..((........))..).))))).......((((((((........)).))))))......)))))))))).((((..((..((((.((.((.((((.....)))).)).))....))))..))..))))..))))))).........((((...(((((((.((((((...))))))........(((.(..(((((((((..(......)..)))))))))..).)))....)).))))).))))..))))))))))))))...(((((...)))))..)))))))))))...))).))))....(((.......))).))))))))...)))..))..))).)).)))))...............((((((......))))))......(((((((....(....)....))))))).))))..)))))))))))))))))..))))..(((......)))...))))))..(((.....)))(((.......)))...((.((((((((.....(((...)))((((((....))))))(..((((........))))..)..((((....(((.(((......)))..))).....)))))))))))).)).......(((((((((.(((((......((........))..((((((.(((((....((((...))))....)))))))))))..))))).))))))))).(((((((((((((...))))))).)))))).
Thermodynamic Ensemble Prediction
(((({(,,{,,....(((({,((((,((.((((((...{(((((({(((((...,,,,((((({,.{{((({{.,||.......,(((((,((({.(((({{.{|}|}.{{{{{((({{,{,{(((,..((((((((((({{{({{........,.,,,)))),|{,.{{{{{|||{{{{{{{{{{{.{(((((......))))}}((((((.(((((((((...)).)))).,(((....|||{{{{{((({.((,(({,.(((((({{(((..(((((........)))))..))|((((...))))}..,{{,......}}))))))}.....})}))))......,...,{((,({({.{{{..,,.}}))}.}))))}}....,,})})})}}))))}}},.})).))))))({(,..,}}||||{((.,{.....,,.,....})))))))}((((((((((((.(((((.({...}).))))).)))))....}))))))(({((((...((((.{{.,|||.......|||,}}||||,{||}}}}...((((((((..,,,{{{,..{,({.{((((({.....,))))))).|||},...{(((((.(((((..|.(((((...))))).|))))).))))))|{..{{{...,,)))))).((((((..((((({...}))))).)))))))))))))){({{(,,{,......))))).||,...}))|||||}}}}|||..(({....,,,}}.,{{{{{{.||||,..,)).)),,,))))),..((((((..((.(((((........))))).)).))))))......,(({(((,{{,,((({{(.{(.,,{|{...(((((((((...(((({,({......,,.{((((({{{,|,,,,((((.(((({{((((...))))))))).)))).....,}})}}}.,}))))}))))).....))))))))).||,.,}}}},.||,||||||||,}}}}}....,..,,{,,,,||.,{{{||{.,{{{{{|||{{..(({((((({{,||||||.|||{{..,,{,,,((((((((.((.....))))))))}}..})))||||}}}}.|||.,.{{{{..,((({,|.{((((((((((((((...)))))).)).))))))}.}))),...}}}}.((....}}.||.,}}}}}}),.}}),.,}|}}}})))......((((((.....)))))).}}))}}....,)),)}}))),|,.(((.((((((..(((..((...(((....)))...))..)))..)))))).))),,|...)}},...,|||}}.))))}){{{|,,|||..||||||||.(((((,.(((({((({{....,,.,{{|||{((({.(({{{..{{||,.......||,|||||...))}))),})},,,|||}}||,((((((.((((((((((((((((((((((((((((...)))))))|{|||((((.(((....))).))}..........((((((((((...)))))))))).((((((((.(((({(..,{({|{(((((((((.......(((((..(((({((({...,||}}}...(((((((((((...((.(((((((.((((.....))))...))....))))),)}..))))))))))).((((((((..((((,({...)).))))..))}}))))),.....{{{(.(((.......})).)))),,....,))))..)))))....(((((.((.((((...)))).)).)).)))..))))))))},,.,}|,{{{.(((((((..(((........)}})))))))}}){{|,....,..}}||{....))}..}}}},.,)))))))))))))).((((,,((((.......))))))))).(((((((((((,,(..{{..((((((({(((((...((((((({,((((..,...,.(((.{(((((({...}))))))).))|{,||..,}}|((((((((((((.....})))}....((((.({.....(((((....((((((......((((((((((((((((.(((((((...........((((.(((.((.((,,(({(.(((({{((((,(.((.((((((((,...,(((.((((((..(((.(((...((((((..(((((.(((.......))).))))).)))))),{{,.....}},((((..(((((..(((((((.(((((((..((((......))))..)))))))....((((((((.{,...}})))))))),.))).))))....)))))..))))....,|{((((((((..((.(((((((..{((({{(((((((((...)))))))))...{|.{(.,,,..,,||,}}})))))..,,.,,.((((((..((.....))...)))))){{,{{....)).)}.(((((.....)))))....}}}})})).)).(((((((((({{(((.....(((.((({,(((((....))))))))).)))(((((({({{,.,...|||}}.,.,,...,{.(((((,....((......))...,.))))).,|,{{........}}.....,,.(((..(((((........((((((....((..........))....)))))).........))))).))).,,((((((..........)))))).,))))))..(((((((.......)))))))))))))))))))))..))))))))}|{{{...{{,.......(((((({{,,..(((,...{{.....|||,.||{....((((.((.((((........))},).)).))))..)})|{.......|}...||{{{{.,{{..,.|||},..}||,,......,.}},},(((((((.(((,....,)))))))))),....,,,....}.,{|{,|........,{((.....))))}.,........)))).|},)))}}}.......})}...}))}}.....(((((.,....,))))).))).)))..)))))).))).,..,,.}))).}}|||.}}},)))}},..{||{....,,))}),..,||,...(((..(((((.....))))).)))({(((,...|||||((((((,,...........,|||}...))))}|....,||,|...{{{..,,....(((....)))....}}.,)))....(((({...)))))................(((..((((((...((((((.........)))))).......((((.(((((.(.((((.(((........)))...)))).).)))))))))........))))))..)))...,((((,{.,,..}}.}||.,....,..,{||.,|{(.{{{,,(((((((((({|....||......,{,,{.||||{((((((.((({...)))).))))))))},,.}..)))}......,)))).)})))),,))),))}..}}}}........,..,,,||}}},,))).,)))))),,..}}}).}})).))).))))..((((((.((((.(((((...((.(((.((...))))).))......))))).).))).))))))....))))))){{{{.........||}|,((...,,..}),...||||,,,,,{{.....({({{{.{...{{{....}))..,..,)))})),,}....((((((...))))))....(((((....)))))....))))))))))))....))))......))))))...)))))....,{{..,..{{.((((....)))).}}.....))))}))))..})))))).((((((..........))))))....))))))))))))........{(......)).))))).}.)))))))((((((......))))))......{{{.{{....,.}}}...,,})..).}))))))))))....||||....{{(({.{(((......(((((..((((((...(((,{((((..((......))..)))))))).)))))))))))..))}}.)))},.}}}......))))))))))))))))..))))))))),)))}})),)}})))),..,,}}))),}}}}}|{.((((((.{......}.))))))||,{{((,,{......})))|(((((((((...)))))))))}.....||||||}}||.||,..||||,.|||{||||||||||,..}||||}|||,((({(((..{{{...}}}..))}||||.|{{{|.{{||||,||||........{||||.|||{.((((((.......,,..((((.(((....))).)))){||{{..((,,..||,.{(({({{......||}||||.{,{{{...((((((.........((((((({.{{{{{{{.....,,.,{{{,{.{{{{{,,||||,.||||,..|}||||{.,{{,{{{|...{{{,,....)))..........((((((((((((((((...)))))).)))......))))))}.,,,,.....,...|||{.....))}}........,},,,)))))),}}}}.,,...,}}}|,..}))),.))|||||}}.}),)))).)))))}|||||,}.},}.)},}|{{,....||||,{(((((((((((((.(((...))).))))),||}.(((((((.......({.((.,....,.}.}}.,,))))))).,,....,.{{..((((.........))))..))|.{{(,..}},..)))))))),,.}}}))}}}))),,,.{((.(((....)))))}.........,.((((....)))).......{{{....|||{,,,..((((((.....)))))).,||||,|,,({((((((......((.....)).,....)))))).))...,}|{(((((.(((((({({{({((((({.((((((..(..((....))..)..)))))).}}),})))}((((.,,,..,)))).{({{{((,...,,..||,||||||{{((.(((((.......))))).)).((((((.....((.(((((...((((((((...)))).)))).))))).))))))))...}}}.,....{({({||..{(........,,....}|||}...}},.,.((((((.......))))))|{||.....))))}||||||.{(((.,({..(((,.((.((.((((.....)))).)).))..}})}}|..}}..))))..}|}}|||.........{||{...{||||{|,((((((...))))))........|||,|,.(((((((((..(......)..))))))))),,).)))}},.}),)))))}))))..})))))},,))))}.,,|||{{...})))},,))))))})))},,,)))})))},...{{{.,...|.}}},}}}}}}},...})}..)),.))),}}.})}}},,.....,,.,.,..((((((......))))))......{||||||,,,},.,,,|...,||||||},||}}..||||||}}}}}}}}}}},.}}}}..(((......)))...}}}}}}..(((.....)))({,((,....)))..,((.({((({{(,....(({...})}((((((....))))))(..((((........))))..)..|||{..,}|||,|||,....,)))},))),....|||||}}||}}}.||.......{(({{{{{|,{{{,,......}|,..,}}}},...((((({,(((((....((({...})))....)))))))))))...}))),)}}}}}})}.(((((((((((({...})))))).)))))).

Transcripts

ID Sequence Length GC content
GUCUCUCCUCAUAAAGCUUCAAGUUCUGAUCCACUUUAAGGUCGCAUCU… 6023 nt 0.4919
Summary

Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the MYH1 mRNA is a specific marker for skeletal muscle tissue identification, with its expression also reported in thyroid tissue [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7]. Extended specificity testing confirmed the MYH1 marker's detection in human esophagus, thymus, thyroid, and trachea tissues, but the overall organ-typing assay maintained high human specificity against animal species and reliable forensic inference when using interpretation rules requiring multiple markers [van den Berge et al. DOI:10.1002/elps.201700241]. A study in pigs demonstrated that the MYH1 gene, a marker for fast muscle fiber type, exhibited significantly upregulated expression specifically in the longissimus dorsi muscle of cold-exposed Tibetan pigs, as identified through RNA-seq and validated by qPCR [Yang et al. DOI:10.3390/ijms24087431].