Basic Information

Symbol
MYH2
RNA class
mRNA
Alias
Myosin Heavy Chain 2 MyHC-IIa MYHSA2 MyHC-2A MYHas8 MYH2A Myosin, Heavy Polypeptide 2, Skeletal Muscle, Adult Inclusion Body Myopathy 3, Autosomal Dominant Myosin Heavy Chain, Skeletal Muscle, Adult 2 Myosin Heavy Chain IIa Myosin Heavy Chain 2a Myosin-2 IBM3 Myosin, Heavy Chain 2, Skeletal Muscle, Adult Type IIA Myosin Heavy Chain Fast 2a Myosin Heavy Chain EC 4.2.1.33 EC 2.3.2 MyHC-2a CMYO6 CMYP6 MYPOP
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_017534.6
Sequence length
6044.0 nt
GC content
0.4978

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1978.30 kcal/mol
Thermodynamic ensemble
Free energy: -2085.13 kcal/mol
Frequency: 0.0000
Diversity: 1719.21
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((....((((((..(((.(((((..((((..((((...((((((..((((....))))....((((((((.(((........)))..))))))))...(((((.(((((((...((.((((((((..((.((...)).))))))))))))...((((((..(((((((((((((((...((((.......((((((.(((...)))))))))....))))))))))))..((((((((((((....(((((....(((.((((....)))).(((((((.....(((((((........)).)))))))))))))))....))))).............((((.((......)).))))..(((((....))))).)))))..((((((.(((..........))).))))))))))))).......))))))).))))))((((((((((((((........)).))))))..(((((((....(((.(((((((((...((((.((..(((.......))).))))))..))))((...((((((...(((((((((.(((......((((((..(((((((.........)))))))..((((..(((((((...))))))))))).......)))))).....)))))))).((((((..((((((...)))))).)))))).)))))))))).))........))))).)))...)))))))((((((((((.(((......)))..((((((.((((....)).))...))))))..((((((..((.(((((........))))).)).))))))..((((....))))((.((((((((((.((((..(.(((((.((((((.....(((.....(((((.(((((((.....((....((((((((((...))))).)))))....))...))))))).)))))....)))((((((.........))))))....(((((((......((((........(((((.(((.((((.....))))))).))))).((((((((..........((((......)))))))))))).....((((.(((..((((((((.((..((((((.......(((((((..............)))))))......))))).)..)))))))))).....))).)))).)))))))))))))))))))))).)..).))).)).)))...))))).))......))))))))))....(((((.(((((((((....(((((((((...(((((((..((((.(((..((.((...((((((..((((((.((((......((((((((.(((.((.(((((...(((...(((((((((((.(((....))).)))))))))))))).))))).))..)).).)))))))).....((....)).(((.(((.((((((((((((.((..(((((((((.(.(((((((((((((.((.((...(((.(((.(((((..(((((((...((((((((((...)))))))))).((..(.((((((((..(((((((((..(((((....((.(((((.(((....(((.(((((((.(.((((.(.(((..(((((((((((((.((((.....))))..((((..(((((..((((((((...)))).((((((((..((((((....)).))))..)).)))))).........((((......))))((((((((...((((........)))).)))).))))((((........))))..((((..(((((((((....((((....((((((((((...))))))))))..((((((((((((.......(((....)))...((((((..((((........))))...)))).)).......))))))).)))))(((((((..(((.......)))...))))))).((((((((((((.(((......)))((.(((((((.....))))))).))((((...)))).......(((((.....)))))(((((((.(((.(((.(.((((((((......((((((...))))))(((.((((.....)))).)))...)))))))).)...)))..))).)))))))))))))))))))..)))).....((((((((((.(((.(((((.((((((..(((((((((.......))))))))).)))))).(((..(((....(((((((((((((.((((((.((.....((.(.((((..(((.(((....)))))).)))).).))..))..))))))((((((..((((...(((.(((((.......)))))..........((((((((..((((.(((.(((.(.(((((....)))).).).))).))).))))(((((.(((((((.((.....(((((((((((((.(((((.(((.......(.((((....(((((((((((.............)))))))))))..)))).)........))).))))).(.((((((......((((((((((......))).((((((((((..((((((.((....(((......)))....)).))).)))((((((..........((((((...........(....(((((........)))))...).......))))))......))))))..(((((...................)))))(((...(((.((((((((((...)))))((((...((...(((..(((.(((........)))..)))....))).))....))))..........((....)).....((((.((.((((........)).)).)).))))..)))))..)))..)))..(((..(.(((..(.(((.....((((........)))).(((((((.(((......)))))))))).....))).)..))).)..)))......((((.....)))).............((((((((((......))).......(((..((..(((((.......))))).)).)))...((((......))))..))))))).(((((.((..(((...)))....))))).)).........(((..(((((.....))))).)))))))))))))(((((.(((((............)))))...))))).....)))))))...(((..((((.((.(((((...))))).))))))..)))......)))))).).................(((((...((((((.........))))))...)))))((((((((...)).))))))...........)))))))))......((((((...............))))))((((((.(((.....((.((........)).)).))).))))))((((((((......(((((........)))))......)))))))))))).)).)))))))....((((......))))....)))))..((((((((...(((.......))).......).)))))))((((((....((((((((..(((.(((..((((((.((((.(((((...((.(((.((...))))).))......))))).).))).))))))...))).))).............)))))..........)))....))))))..))))))))))).))))..))))))..))))).)))))).))....))).)))..((((((((.......(((.(((((.......(((((((((((((.((........))))))...((........))......((.((((....)))).))......(((...((((.......))))...)))..(.((((((.(((((....((((((((((..........))))..))))))...........((((((......))))))))))).)))))).)...........(((..((((................))))...))))))))))))..(((((..((((((...((..(((((..((......))..))))).)).))))))))))).......((((.....((((......))))....)))).......))))).)))..)))).))))........).)))).))).))))))))))...))))).))))..)))).....))))...)))))..)))))))))))))).)))..))).).))))).))))))))))...)))))))).)).......(((((..(((((.((((.((((((((...)))))))).......((((............)))))))))))))((((..(.....)..))))..)))))......((((.(((...((....))....))).))))....((((((...((((.(((((((.....)))))))(((((((((....(((..((((((..((((((((.(.(((...)))).)))))..)))...(((((((((((..(.(((..........))).)..)))).).))))))........))))))....)))...))))).))))..(((((........................))))).))))...)))))).)))))...))))))))).(((.((....)).)))..))))))))..)..)).....(((((((.(((((((((((.(((...))).))))).))).))))).))))).....((((.....(((......)))...)))).......................)))))))..))))).)))..))))).)).))))))))))))).....(((.(((....))))))...........((((....)))).......).)))).)))))....((((((.....)))))).)))))))))))))).))).))).((.....))..((.((((....)))).))(((.(((.((((......((((....)))))))).))).))).....)))))))))).)))))).)).))..))).)))).((((((.((..........))))))))...)))))))...)).))))))))))))))....)))))))))))))((((((((...)))).))))((((.........)))).)))))))...)))))............))))))))))))))..))))).))).....(((..((.....((((((....)))))).....)).)))..(((..((....((((.....))))....))..))).((((...))))...))))))......)))))))))).(((((.(((.(((((..(((...........(((((......)))))..((((((((.((((.((((.....)))).))))..((.((((....)))).)).....)))))))).....)))....)))))....))).)))))..(.(((((.((((((((.((....))....(((..(((((......)))))..))).........((.((((((......)))))).))......................))))))))(((.(((.(((.((((......((((..(((....(((...((((....))))..((((.(((.((.((.(((....)))..))))..)))))))....((((((..(((((((....)))))))...(((..(((...(((.......)))...)))..)))........))))))....(((((....))))).)))....)))..))))........)))).))).))).)))..((((((((((((((....((((...))))...))))))))))))))))))).)...(((((((((..(((((((((.((............)))))))))))..)))..))))))
Thermodynamic Ensemble Prediction
((((((((((....((((((.....(((((({.,,,{({((((.(((((((({.((((....)))){.((((((..((((((((((.{(((((((.(((,....((,(((((((((((((({(((.((((((((((((.....((((....((({.(((((((((((.......))})|,}}))))),..........((((((.(((...))))))))).{(((((....)))))}...)))....))))...))))))}......((((....)))).})))).)))(((.(((({{,,.....,)}.)))))))))))))}....((((((......{{{....((((.((......)).))))..,|||((((({....((((((((((((((.(((.,........))).)))))|(((((((.........}))))))}{((((({{,{(({{((((,..,,,,,,}..|}|||{,{{{,,{{....|||.,,||,||||,,.((((.{{..|||.......|||.||}|}}..}))}|}...(((((({..{{{{((((,,(((...,,,((({{{,.{||{{{{.,....}..}|||}},.{((((..(((((((...))))))))))))..,,,,)))}}).....)))))))).((((((..((((({...}))))).)))))).)))))))|||,||,,,......))))))))...,,,||||(,..(((((..((({......{(((((((((........{((((((((((({{...|}}||,..((.(((((........))))).)),,||||{{{(..,.{((((({...{..(((((((((((.....,((((.(((((,((({{......}}}}},}|{|||..,,|||,|||,||||||{|||||,..))))}.||||{((..,,..}}}}}}}..{{{{...,,({,({{{{(.........}}}}}},...,}.|))))........,...(((({(((((.(((.((((.....))))))).))))).})))),||,..,,},}}{((((......))))),)))}))).))))))))..)..))))))),.}})}}}}}.}.,,.,}))))))))}.,{{{..((((..,,))))))))).,,.....((((((.......((((((...((((((((,,{{(((.{((((((((....)))......((((((.....))))))....((.((((((....}))))).}}.})))))....))))}|(({{.,,.,.}}(((((((.(((((..(.(({((((..(...((((((({{((,..,},|((({...})||.,....))))))))))..(((((((((((.(((....))).)))))))))))..(((((((({{{(({,(,({,...{{{{{,{|{(({({,.,..,,,,.,,||||||||}}.||}}}}}})},{(((((({...)))}))}},,}}|||,.((((((((((.((.{((({.{,..((((((((((...)))))))))).{{,,(,{.{{{{{,}}.,,),}}})).))})}....{{.(({((((((....(((.(((((((.(.((((.{.(((..(((((((((((((.((((.....))))..{(((..{((((,,((((((({,,,|||,,(((({(((..((((((....)).))))..))}|)))}},........(((,..{((((|.|,(((((((...((((........)))).))))},)))))))}..|||..|||}..((((..(((((((((..,,{{{{..,.((((((((({...}))))))))).,{(((((((((((.......(((....))),..,{((((,.((((.,,..,..}})),.,)))),|,.......})))))}.}}))|(((((((..(((.......)))...))))))),(((((((((((({((,.,,,..,,|((.{((((((.....))))))}.))|,,{...,))))}},..,(((((.....))))){((((((.(((.(((.{.((((((((......((((((...))))))(((.((((.....)))).)))...)))))))).)...)))..))).)))))))))))))))))))..||||...,.((((((((((.(((.((((|.{(((((..(((((((((,......))))))))).))))))||||...,.|,(((((..,||}|}...((((.({((..{({((,..{((({.,(({((({{..|,,,..{(({,{{{.,..||{{|||}|,|(({{{,,{{{{,..{,{.(((((.......)))))...,}},.}}||{{{{{{..{(((,(((,(((.(,(((((....)))).}.}.}}}.}}}.}})|({{{||{{{{.{{,{{{....(((((((({{(((.(((((.((({({....(.((((.{(,{((((((((((.............))))))))))))})))).)......,,}}}.})})}.(({..,||}.}}}}|||||}}}}.,,,,,,(((((((({,{.{,..((((((.{{...,||{,,....}))..,.)),))}.}}}|,,|,|||||,,.,,.})))}.................{{(((........)))},...{,..,{{.|{({,.,,..{{.{({{.{{((({{,...............||{{||,|,(({{(({|.(((,...)))...)))))))|,,.}}},,.},,..))})),)})).)}..})....}},...)))}}}|,,.,|||,....,.....))),.}},.,..((((.((.((((........))}}).)).))))..}}}||......,|....||{{{{,.{{..,.|})},..}||,,......,.}},}|(((((((.(((,....,))))))))))..,,,}}},...,.|{|{{,........{(((.....)))),........,.}}|||(((({((,,,...,))}}.,...{|{,.||..(((((.,....,))))).||{|||{{.{{{(,....,||}|,,},|||,|.(((((.((..(((...)))....))))).)).........(((,.(((((.....))))).}})}}}||},..((((((.(({{(.,,,........)))),}}.)))))).....((((({......,((((.(((....))).)))))))))).....((({...}))){{{{....,}}.....{{{{..{((((({..((((((.........))))))...|||,.((((((((...)),})))))..}}}...},||}.}}||||,,||,.{({{{..............,,}))))}|||{{|,|||,}..}||},,,.}},..,)).))}},}.))))))||||{|||},....(((((........))))).},}}}}))))))}})}}}))})))||||....{||||,..,.,{||,.,.|}}||,|||||||||...,{,...,.........{{{{|,|||||,.,||(((...,(((((((({.(((.(((..((((((.((((.(((((...((.(((.((...))))).))......))))).).))).))))))...))).))).,{,,.........)))),{{...,...})}...})))})}..}}}||,||}||,|}},..,,||||{{(((..,,{{{{{(,,.....})))..,}))))}}))....,.{((....))}.,.{,,,,{..{{{{{{|||||||||.||..||,.|||...,....,|..,||..}}}||}|{{|,}.,)))},))}}}},,,)}.}},},),,,)}},)}}),)})),..,.,,||||||{,||,,,,,{((((((((..,....,..)))),.})))))}}},.}}.,,.((((((......)))))),}|||.,,}}})}}.,.......,.((({{(((,....,|,.......|||,.{....}})))))}}}}..{||||,,{|{{||,,,((..(((((..((,,...,))..))))).)).)))))))))))..,},..((((..,..((((......)))).,..)))).....,.}}))))))}..|||....)),.......,.)))).))).))))))))))...})))),)))),.))))..,.,)))).},))))).,)))))))))))))).)))..))).}.))))).))))))))))...)))))))).)}.....,..)).))},))))))),{.((((((((...)))))))).}}}))))))).)..)))}..}))...}..))))).)))))))....}}},..,...,,|{.....}.((((.(((...((....))....))).)))).)))).))))..))))))(((((((.....))))))).))))))}))))))))},{{{,{,....{(((({.{.(((...}))..)))))}))))..))))}..}}}}}..}.}))))}.........}))))))))....,((((.{{....))..)))}.)))))}.))))))....,..((((.....))))........,))))),,)).)}........))).)))))))}})))))))...)))....)))))),.{(((((.......)))))},.....(((({{(((((((((((((.(((...))).)))).{({..(((((.,.{..,{.((.((.,......}.)).}},))..)))))}..}}}({..((((.........))))..))..{{{...)),.))))))))),,.,,,}},,,)}}}}}.(((.(((....)))))).,.})))))))((((....)))).......,((....}|(((,{,.((((((.....)))))),,||||.||,({((((((.,,...((.....)}..},..))))),.))...}|{{{.{{{.{|||}.....((((,,,,}}|||||}.|,,{|}}..}}..)}})))))},)))})),}}((((.|....,)))),|{,,((((..{((.(((((((,(,{.((.(((((.......))))).)).{|.{{....}})).,..|.).))))))).))}.,)))},,))||||}|,|}..|||,,,.,.,,),...,||}))}}.{{........}}..,.)))))))))))..,{{((({........)).))}}|(((({....}))))}{{....)},,,..(((..((....((((.....)))).,..))..))).((({...})))...))))))......)))))))))).(((((.(((,(((((..({{,,.........{{{{{.,,,,,||}}}..||{|||||.{(((,((((,,,,.}}||,}}}}..((.((((....)))).))....,))}})))),,,..})),...))))),,..))).)))))..{.(((((,(({{({(.{((,...||....|||,.{{|||.,,...}||||.,}||....,,.,,((,(((({{....,,))}))}.||.,.,,|,,,.....,,,......,})))},{{||||.,{{|||{||,|{{...{(((((,{...,{{,...((((....})}}..{|||,,,,.|{,||,||{....))}..,}))..)))}}}}...,{{{{(...(((((((....)))))))..,||{,.|||..,|{||.....,}}).},))},.}((((((...{{.(,(((....,|)).}.}))))))).}....|||,,..,},,...,,,})}},}}),))).)}}..((((((((((((((....((({...}))).,.))))))))))))))))))).)...(((((((((..((((((((,{((............)))))))))))..))),.,)))))

Transcripts

ID Sequence Length GC content
GUCCUGCUUUAAAAAGCUCCAAGGUAAGUGGGAGCAGGACGGGCCUUUC… 6121 nt 0.4991
GUCCUGCUUUAAAAAGCUCCAAGAACUGUCUCACUCCCAGGCUACAUCU… 6044 nt 0.4978
Summary

Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]

Forensic Context

A study in mice demonstrated that the MYH2 gene, encoding a muscle-specific protein, was downregulated in adult burned animals but not in young burned animals following a severe scald injury, indicating an age-dependent transcriptional response to burn trauma in skeletal muscle [Song et al. DOI:10.1038/s41598-022-26040-1]. A study in pigs (Sus scrofa domesticus) demonstrated that the MYH2 gene expression was significantly upregulated in the biceps femoris of cold-exposed Bama pigs and in the longissimus dorsi muscle of cold-exposed Tibetan pigs following a 3-day cold exposure, as part of a broader transcriptional analysis of skeletal muscle adaptation [Yang et al. DOI:10.3390/ijms24087431].