Basic Information

Symbol
MYH6
RNA class
mRNA
Alias
Myosin Heavy Chain 6 Myosin, Heavy Polypeptide 6, Cardiac Muscle, Alpha (Cardiomyopathy, Hypertrophic 1) MyHC-Alpha Myosin-6 MYHCA Myosin Heavy Chain, Cardiac Muscle Alpha Isoform Cardiomyopathy, Hypertrophic 1 Alpha-MHC CMD1EE CMH14 ASD3 MYHC SSS3
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_002471.4
Sequence length
5940.0 nt
GC content
0.5751

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2205.00 kcal/mol
Thermodynamic ensemble
Free energy: -2296.11 kcal/mol
Frequency: 0.0000
Diversity: 1970.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((..(((((.(((....((((((((...((((((.....((.....)).))))))(((((((..(.((....(((.....)))((((((.(((((((((((...((.(((((((.(.((((.....(((.(((.(((((.((......)).)))))))).)))...)))).).(((((.(((...(((((((......))))))).(((...(((((((((((.....)).)))))))))...)))....((......))......((((..(((..(((..((((....((((((((.....(((((((.((((..((....)).)))).)))(((.(((.(((((((.((.((.(((((((.(((((((((.((((..((((((......((((((((((((.....(((.((.(((..((((((.((((((.((((...(((....((((((((((((((...))))))((((((...))))))..(((((...((.((((((((.(((...))).))).)))))))...))))).....((((.(((((....)))))..(((.((((...........)))).))).(((......)))))))((.((((((((.((((((.....))))..)))))).)))).))......))))))))))))))).))))))))))))....((((..((....))..))))))).))))).....)))))))))))).....)))))).)))).(((.(((...))))))..((((......)))).....((((.....)))).........((..(((...)))..))..)))))))).(((((((((((.........(((.(((.(((((((((.....((((.((((.(((((...))))).))))...))))....))))).)))).....(((((.......(((((.(((((.((.(((((.((((((..((.....(((((..(((.(((....))))))..)))))..(((((((((((((((((((..(((((....((((((..((((..(((.((((......((((((((...((((......))))....)))..))))).....)))).)))..))))(((((((((.(..((((.....))))..)((((.((..((((((((((((((((.(((....))).))).....(((((....(((((((........)))))))..)))))...))))))).....(((.((((..(((..(((((.(.(.(....).).)...))))).))))))).)))(((((.....)))))..))))..))..))))))((....))))))))))).....(.(((..((((.((((((.((((......))....((((.((...(((((((((.((((.(((((...))))).))))...(((((((.(((((...((((..((((..(((((((((.(.((((((..((..((((((((.((.......(((((((((((((........((.(((((..(((.((((((..((((.((((((.....((.....)).....))).)))))))(((((((((((....((((.(((((...((((((.....(((((((((...(((((.(.((((.....))))).)))))...)))).((((..(((........))).))))...................)))))..((((.....((((((...((...))...((((.(((((((..((....)).))))))).)))).......((((((.(((.(((........)))))))))))))))))).......))))...(((((....((((((.(((((((...((((...(((((((((.((((((..((((.((((((((((((((..((...((((...((((....))))))))...))..))))))...........(((..((((((....(((((((((((((.....((((...)))).....((..(((((((...((((((.......))))))........(((((((((((((....((((.....))))..)))))))))..))))....))))))))).(((((((((((....((((.....((.((((.(((((...(((.((..(((....)))..)))))((((((.((....((((((((.......((.(.(((((....(((((((..((((...))))..).))))))....)))))..).))((((((.(((....)))))))))..((((.(((....((..(((...(((((((((((....))))........((((.((((((((.(((..((((((((((((((..(.((...)).).))))))).))..((((((((.(((((.......))))).))..)))))).....((((............))))((((((((((((((((((....)))))))...((((...((((((((((((((((...)))))))(((.(((((.....)))))...))).((((((.((......((......))....)).)).))))..)))))))))..))))((.((((..((...))..)))).))....(((..(((((........)))))...)))......)))))))))))((((((..........)))))).)))))))).)))))............(((((.......)))))))).))))..((((((((((........)).)))))))).))))))))))..)).))).))))....)))))))).)).)))))).......))))))))).))))))...))))).)))))).....((((.......))))....(((.((....)).)))))))))))))))).(((...))).))))))..)))...............((((.....))))...)))))))))))))))))).((((....))))(((.((((((((..((((.......))))...((.((((........))))))((((......(((((((..((........))..))))))).....))))..)))).))))..)))..(((((.....)))))))))))((.((......)).))...((((.(....).))))...((.......)))))..)))))))))..(((((.(((..(....)..))).))).))..((((..((((.((((((.(((((........)))).........).)))))).))))..)))))).))))))....)))))))))))..))))).))))((((.......))))...(((.........)))....((((((...((((((((.(((..((((((((.((((((((((((........)))))......)))))))......(((((((((((((((....(((.....(((((((.....((((.....)))).((((((.......)).))))........((((..((((..((((((.......((..(((.(((((((((..((((((((((((....((((((.((.(((((..(((.......))).)))).).))))))))..(((((((.(((...........((.((((...((...))...)))).))..((.......(((((((........((((((((.((((..(((((...)))))...........(((((.(((...(((((....((((((...))))))......))))).((.((((....((((...(((......)))...))))...)))).))..(((.((.(((..(...(((.(((((.....(((...((((((((..((((((((((.((((...((......))..))))..)))))..)))))...)))))))).....(((.....))).....))).....))))))))....)..)))...)).)))....))).)))))...((.((((((((((((.(((.((.((.(..((((((((....)))))).).)..).)).))...)))..)))))).)))))).))((((..((((.(((((.((....)))))))...)))))))).............)))).))))))))........)))))))......))........))).))))))).)))))))...(((.....)))))))).(((.......)))..((.((((((.........(((..(((.((((((......((((...((((((((..(((.(((.((.((((.((((....(((((.((((.(((..(((.......(((((...)))))......))).)))...)))).))))).....((((((.((.((((....)))))).)))))).....))))))))))))).))).....))).)))))...))))....(((....((((.(((.((((.....)))).)))))))..)))...........((((((((..(.......((((((((.((...(((((..........................))))).))))))))))....)..)))))))).....)))))).)))...))).((.((((.((((((....)))))))))).))..)))))).))....)))))))))))).(((((..(((..(..((((........))))..)..))).))))).........))......)))))).))))..))))..((((((.....))))))..((.(((((..((.....)).))))).))....)))))))...((((((((....((..........))....)).)))))).....))).....))))))))(((((.((.....)).))))).))))))).................))))))))..))).))...((....))....))))))...))))))))))))))))).((.((.(((((.((.((...)).)).))).))..)).))......)))))).)))..))))))))))))))))).)))))))))))))..))))))))).))...)))))))..))))..))))....))))).)))))))....)))..))))))....)))))).......)).)))))).))))..))).)....((.((((....)))))))))))))))))..)))))))).(((..((((....)))).....)))........((((.....)))).)))))))))))((((...))))......(((........))).))..))))))((((....)).))))))).........((((......))))......)).))))).))))))))))((((.(((.....))).)))).))).)))..........)))))))))))...).))))))).))...)).))))))).)))))).((((((((((..(((...)))...(((((((..((((.(...((.(.((.....)).).))...).))))...)))).)))...................))))).))))).(((...)))))))....))))))))....))))....))))))..)))).))))))))..))))))).))..))).........((((((..(((((((...((.((((....)))).))...))...))))))))))).....)))..)))))))))))....((((........)))).)).)..)))))))...(((.....)))....))))))))......))).)))))..)))((((.....................))))......
Thermodynamic Ensemble Prediction
...(((..(((((.(((....((((((((.,.{(((((.,,..{|.....}).})))}}(((((({..(.{{,,..(((.....}}|((((((((((((((((((...((.(((((((.{.((((....,(((.(((.(({(({(,......))})))}}))).))).,.)))).).(((((.(((...(((((((......))))))).(((.{,(((((((((((....,)).))))))))).},)))....((......}),.....((((.{({(,.(((..((((....((((((((.....(((((((.((((..,,....}}.)))).))}(((.(((.(((((((.((.((.(((((((,(((((((,..((({.,((|(((,.....((((((((((((.....(((.((.(((.,{(((((.{(((((.((((...(((....(((((((({(((((...,||}||(((((,{{{||||||..,||||}..{.(((((((((.(((...))).))).)))))),,.{|||||,...,{{((.(((((....))))).}}.,.{|||},..{((({..(((((.{{.(((,....,))),)).))))}.))))|,{,,(({.....))))),,})),),))))}|}|}}}}}))))))))})))))).)))))})))))}....{(((..((....))..)))}})),)}))).....))))))))))))....,}}}|}},||}}.((({(({..,|||,,,..{(((,{,...},},.(((((((((((,,|{{,...((,,,,({.{{{,...,||{{||,{|,|,...{{((((((({({(.,,{((....}},.,},|((((((((.....((((.((((.(((((...))))).))))...))))....))))).)))}.{{{|||......}}}||||||{(({({,{{,...||{{{|((,({((.....(((((..(((.(((....))))))..)))))..||||,||||||||||||{||,||||||},.,|||{{|{((,.(.(((.((((((((((((,(((,,..,...}}}.||}}})|.({..(((.,({((......,,)}))..}))..||..|}}}}}}})}..)))),.))))..|{||,,||}}|}}}}}|||,,{{({{.{{|....))).)))..,..(((((....(((((({.,,....,)))))))..)))))..{||(||||...,,(((.(({{.{({{..(((((...(,{....}.}.}.,.))))).})))))}.}}){{{{|||,||)|},},.||||.,|}}||||||}{||..{{({{({,,{{{.....{{|||,,|||{,|{||||||,||.||..,}}|}}|||||,|.||,.||||||.,{((((.(((((...))))).)))).,..{|{|||,|{{{{..,((((..((((..(((((((({((,((((((,.{{..(((((((..{{.,..{{{(({(({(((({{{..{{{,{.{,.{{((({{(((|{(({((,{{,{({{..,..,...{{{,||{{|||,.||||||}||.|||||||||{{{{,{{{{,{((({({((,.{(((.{{,,,..((({,((((,,.{{{||||,{(((,,.,,)))}.,)))})}}})))),||{|,.|||.,,}.,,,))).})))..,||||||,.,..|{.,{|||||..{{{{.....{{(((((..(((.{{{...{(({.(((((((..((...,),.))))})),)))|(({....((((((.(({.(((........)))}))))))))))),......,..||,{{,{{,....}},.|||||(((((((({{.((((...(((((({((.((((((((,,((((.((((((((((((..((...((((...((((....))))))))...))..))))),........{{{(,,.((((((((((({{{(,((,(((((((...((({...})))....,(({..(((((({{{(((((,.,,.{,.|||||,{{{{({{{(((((((((((((,...((((.....))))..))))))))}..,,,}|||{||||{||,,.(((((((((((....(((({,,..{,.((((.((((({{((,(.{{..(((...,))}..||,||((((((.{{{,..{{{|||((.,,....{(.(.(((((....(((((((..((((...))))..),})))))....))))).,,}},(((((,,(((....)))))))))..((((.(((....((..(((...((((((({{{{...,||||,{{,,...((((.((((((((.(((..((((({,(((((((..,.{{...}}...))))))).}|..((((((({.(((((.......))))).}}.,))))))..,,.((((..........,.))))((((((((((((((((((....)))))))...{{((...(((((((((((((((,...}))))))|{{.{{{{{,,,,.||||}...||..{{((((,{{....,}|}}.}...}}}...,}|}}.},})}.)))))))))..))}|((.((((..((...})..)))).)),...(((..(((((........)))))...)))......)))))))))))((((((..,....,..)))))).)))))})).)))))}}..,.......{{{{{....,,,)))))))),))}}..((((((((((........)),}))))))).))))))))))..)).))).))))....})))))))})).)),)})}}}....))))))))).)}))))...))))),,))))).....,{(({.{{,,.||||....{{{.{,....}).)))}))))))))))))}|},.}}})).,..,,,...}},}}},,}}},}....((((.....))))....})))}..|(({(.((({,((((....))))}}}.}))},,}}..((((.......))))...,{.((((........))))}}|}.||,,|||||||||{..,..{{{..{{|}..,,))))),)....))}..)))))}))))))),,}).}}}},,},.)))))))))))}}}}....,..))))))).))))..))))..(((.({(({.{{...,.|,...,|(((((((.{{(({..(((({.(((((....|....,}..)))))..((((.((((((.(((((........)))).........).)))))).))))..)))))....||||...,}}},,,.,.,,))))),}},)))))))}.,{.(({......))).}},....}),,)).)}}.}}.}})}))},)})))))).))))((((.((((((((((((........)))))......))))))).}.}}|{,{{{{,,,(((({......})}}),,|(((((,.....}})}}}}}}))))}){{{(((((...{{.....,.....,,.||||}.|(((..{{{{{,...,.{((((((((.(((.....))))).))))))),|.,..((((((.{(.(((((,.(((.......))).)))).).))))))))|||||{|||,,,|,,.|||.,..,{(||{{{.||||.,|,....||||,.},.|,.|,,,,,{,{{(((..,||,|,|{{,({((.||((.,(((({...,}))),,},}}}}}..{|||..|||...(((({....{(((((,,.}}}}||,,....))))).{,.{|{{..,.((((...(((......)))...)))),.,)))}.)),,|||.,|.,}|}}|,.,{{..||||{,,...{{{...((((((((..((((((((((.((((...((......))..))))..)))))..)))))...))))))))....|(({.,...})).}..,)}}....|)),})))).,|,||.((((..((((.....)))).}.))))..((.((((((((((((.(((.((.((.(..((((((((....)))))).,.),.).)).))...)))..)))))).)))))).)){{((|.||{{.((((,,{{....)))))))..,))))))}),......,..,}|}}}||),|||}}}|,.}||{{|{||}||....((({{.......,,||||||,,||||},}}},.,)})}..}.)))),},,.|||}......)))..}|))|||||.,|||.,..||}},|||,|||}||.},,..||,|.,.||}|||||}.|}}}||.,||,{|(({((((..{{(({(({((|(,(((..(((.......(((((...)))))......))).)))...})}}.})))}.,}},|(((((.((.((((....)))))).))))),.....}}}})}}}}))))}))}}},,.|{|{|}}}}.}}))).....{|{||..{{((.(((.((((.....)))).))))))).,)})}},,.......((((((((..(.......((((((((.((...(((((..................}.}.,...))))).))))))))))....}..)))))))).....||||||.||||,,}}},||{({(({(((,,{...,}|||||||||.,,.},,))|)}})....))))))))))|||(((.,.{(((..,..((((........)))),})}.,,))))))}...,..}},,},}},},))},.}.))))..}|||.,(((((....}}))))}}.,||}||||{,.{{,,..,|}.}}))).},,,,|))})))}...{|||{{{|,..,||,.........},....}}.}}))))..,|,|.||{...|))}|)}|(((((.((.....)).))))}}},|}}}}|,.,.,{{,,||}..|.}}}))},},})))}))...||....}}...|||||}||{.|,,||||||||((|{{..{|.{,,|{{{,.{,.,..,.}}|||,|||||}.{{||||,.....}}))))}}})}|}}}}||}}}}}})))|}|})}}}|}}}}}}),,},}}}}||,,}|{{{,}}||||,,}}||,.}}}),}..})}}).)))))}},))))}||{||||||{{,{(((|....||(||((({(.{{..{,,......,....|{{.(({{,.,,}},}))||||||,,||,...|}}},|}}|||.}|||{}},,)))),....|||,..,,,..((((.....)))).)).}||.,})),))})}})))).,,}},})),.....}}}}|,||.},}|,((((((....)).)))).||.........{(({.,,,,.||},...)).})})),.}.}})))))),,{{||,||{.....))),)))}..))))))),....,|||||}},..))))}..}.))))))).))...)).))))))).)))))).((((((((((..(((...)))...(((((((..((((.{...({.{.((,....}).).))...,.))))..}}))).)))...................))))).))))).{{{...}})))))....))))))))....))))....))),)),,)))).))))))))..))))))).))..))).........((((((..(((((((...((.((((....)))).))...))...))))))))))).....))),.})))))))))}....((({........))))|}},,,,)))))))...(({.....))).,..})))))))......))).)))))..))){{{{|{{,......}},........)}))......

Transcripts

ID Sequence Length GC content
AGAGAGACUCCUGCGGCCCAGAUUCUUCAGGAUUCUCCGUGAAGGGAUA… 5940 nt 0.5751
Summary

Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]

Forensic Context

A study in mice demonstrated that the MYH6 is a marker for ventricular cardiomyocyte cluster vCM2, where it is highly expressed [Bian et al. DOI:10.3892/mmr.2025.13680]. In human forensic medicine, the MYH6 is proposed as a candidate gene/protein for unexplained sudden death, associated with impaired contractile regulation [Sacco et al. DOI:10.3390/ijms27020670]. A study in rats demonstrated that the MYH6 is a cardiac development-associated gene whose expression is significantly downregulated in adult cardiac fibroblasts compared to neonatal and fetal cells, as identified via RNA sequencing and principal component analysis [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].